ID: 1170598914

View in Genome Browser
Species Human (GRCh38)
Location 20:17825959-17825981
Sequence CTGGCAAAAGATGCTGTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170598912_1170598914 -10 Left 1170598912 20:17825946-17825968 CCATAAACAGCAACTGGCAAAAG No data
Right 1170598914 20:17825959-17825981 CTGGCAAAAGATGCTGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170598914 Original CRISPR CTGGCAAAAGATGCTGTCTT GGG Intergenic
No off target data available for this crispr