ID: 1170599273

View in Genome Browser
Species Human (GRCh38)
Location 20:17828612-17828634
Sequence GAGGGGTGTTACCAGGTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170599265_1170599273 12 Left 1170599265 20:17828577-17828599 CCTCCTGGAGCAGACAGCGAATA No data
Right 1170599273 20:17828612-17828634 GAGGGGTGTTACCAGGTGATAGG No data
1170599264_1170599273 13 Left 1170599264 20:17828576-17828598 CCCTCCTGGAGCAGACAGCGAAT No data
Right 1170599273 20:17828612-17828634 GAGGGGTGTTACCAGGTGATAGG No data
1170599263_1170599273 16 Left 1170599263 20:17828573-17828595 CCTCCCTCCTGGAGCAGACAGCG No data
Right 1170599273 20:17828612-17828634 GAGGGGTGTTACCAGGTGATAGG No data
1170599266_1170599273 9 Left 1170599266 20:17828580-17828602 CCTGGAGCAGACAGCGAATACAC No data
Right 1170599273 20:17828612-17828634 GAGGGGTGTTACCAGGTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170599273 Original CRISPR GAGGGGTGTTACCAGGTGAT AGG Intergenic
No off target data available for this crispr