ID: 1170601044

View in Genome Browser
Species Human (GRCh38)
Location 20:17841888-17841910
Sequence GAGCTGAGACCCAGCCATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170601044_1170601047 19 Left 1170601044 20:17841888-17841910 CCGTGATGGCTGGGTCTCAGCTC No data
Right 1170601047 20:17841930-17841952 AGGCTGTGTCAGCCTGAGCATGG No data
1170601044_1170601048 20 Left 1170601044 20:17841888-17841910 CCGTGATGGCTGGGTCTCAGCTC No data
Right 1170601048 20:17841931-17841953 GGCTGTGTCAGCCTGAGCATGGG No data
1170601044_1170601046 -1 Left 1170601044 20:17841888-17841910 CCGTGATGGCTGGGTCTCAGCTC No data
Right 1170601046 20:17841910-17841932 CCAGTGATTTTGAGCTGATGAGG No data
1170601044_1170601049 25 Left 1170601044 20:17841888-17841910 CCGTGATGGCTGGGTCTCAGCTC No data
Right 1170601049 20:17841936-17841958 TGTCAGCCTGAGCATGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170601044 Original CRISPR GAGCTGAGACCCAGCCATCA CGG (reversed) Intergenic
No off target data available for this crispr