ID: 1170604693

View in Genome Browser
Species Human (GRCh38)
Location 20:17866759-17866781
Sequence AACCCCATTCTGTGACTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170604691_1170604693 -4 Left 1170604691 20:17866740-17866762 CCAAACTGCCTGGGATTGTAACC No data
Right 1170604693 20:17866759-17866781 AACCCCATTCTGTGACTTCCTGG No data
1170604688_1170604693 10 Left 1170604688 20:17866726-17866748 CCTAGGCTTTAAAGCCAAACTGC No data
Right 1170604693 20:17866759-17866781 AACCCCATTCTGTGACTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170604693 Original CRISPR AACCCCATTCTGTGACTTCC TGG Intergenic
No off target data available for this crispr