ID: 1170607890

View in Genome Browser
Species Human (GRCh38)
Location 20:17887454-17887476
Sequence TAGCACCATCTCTGAGGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170607886_1170607890 -5 Left 1170607886 20:17887436-17887458 CCAGCAAACTTTCTCCCTTAGCA 0: 1
1: 0
2: 1
3: 9
4: 166
Right 1170607890 20:17887454-17887476 TAGCACCATCTCTGAGGCCACGG 0: 1
1: 0
2: 0
3: 21
4: 209
1170607884_1170607890 11 Left 1170607884 20:17887420-17887442 CCTTTTCAGACAAATCCCAGCAA 0: 1
1: 0
2: 1
3: 22
4: 244
Right 1170607890 20:17887454-17887476 TAGCACCATCTCTGAGGCCACGG 0: 1
1: 0
2: 0
3: 21
4: 209
1170607885_1170607890 -4 Left 1170607885 20:17887435-17887457 CCCAGCAAACTTTCTCCCTTAGC 0: 1
1: 0
2: 1
3: 21
4: 286
Right 1170607890 20:17887454-17887476 TAGCACCATCTCTGAGGCCACGG 0: 1
1: 0
2: 0
3: 21
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170607890 Original CRISPR TAGCACCATCTCTGAGGCCA CGG Intergenic
900795060 1:4702823-4702845 TAGCTCCTGCTCTGAGGTCAAGG - Intronic
902368905 1:15993499-15993521 TGGGACTATCTGTGAGGCCAAGG + Intergenic
903934166 1:26883414-26883436 TACAACCAACTCTGAAGCCAAGG + Intronic
905199653 1:36307184-36307206 TTGCACCATCTTTGGGGCCTCGG - Exonic
905439374 1:37984616-37984638 TATAAATATCTCTGAGGCCATGG + Intronic
905764403 1:40588103-40588125 GAGCAACATCTCTCAGGCTAGGG + Intergenic
906071601 1:43020908-43020930 TATCCCCATCCCTGAAGCCATGG + Intergenic
906223740 1:44103981-44104003 CAGCATCATCGCTGAGGTCAAGG - Intergenic
906673370 1:47676330-47676352 TCCCACTTTCTCTGAGGCCAAGG - Intergenic
907957865 1:59248292-59248314 TATCAGCTTCTCTGAGGCCTGGG + Intergenic
911374358 1:97032950-97032972 TAGTCCCATTTCAGAGGCCATGG - Intergenic
912364315 1:109120479-109120501 CAGCACCATCTCTGAGGAATGGG + Intronic
912694115 1:111828073-111828095 AAGCAGCATTTCTGAGCCCAAGG + Intronic
913669853 1:121086969-121086991 TATCAGCCTCTATGAGGCCATGG - Intergenic
913687733 1:121248968-121248990 TAGCTCCATCTCAGAAGCAAAGG + Intronic
914021616 1:143874367-143874389 TATCAGCCTCTATGAGGCCATGG - Intergenic
914039591 1:144036616-144036638 TAGCTCCATCTCAGAAGCAAAGG + Intergenic
914149865 1:145031321-145031343 TAGCTCCATCTCAGAAGCAAAGG - Intronic
914660104 1:149782318-149782340 TATCAGCCTCTATGAGGCCATGG - Intergenic
914747997 1:150513437-150513459 CAGCTCCACCTCTGAGCCCAAGG + Exonic
915086705 1:153394192-153394214 CAGGTCCATCCCTGAGGCCAAGG + Intergenic
918163297 1:181920674-181920696 TAGCACCATCTTTCATGGCAGGG - Intergenic
920106790 1:203559122-203559144 TGCAGCCATCTCTGAGGCCAGGG + Intergenic
920148289 1:203882134-203882156 TAGCACATTCTAGGAGGCCAAGG + Intergenic
920475058 1:206267490-206267512 TAGCTCCATCTCAGAAGCAAAGG + Intronic
1063353044 10:5373960-5373982 TTTCCCCATCTCTGGGGCCAGGG + Exonic
1066539392 10:36428908-36428930 AAGCACCATCTATGAGGGAAGGG + Intergenic
1067565608 10:47334563-47334585 CAGCACCCACTATGAGGCCATGG - Intergenic
1067738320 10:48876538-48876560 TAGCACTATCTCTGGGTGCATGG + Intronic
1068608652 10:59034097-59034119 AAGCAACATCTCTGAGCCCTTGG + Intergenic
1068947019 10:62739615-62739637 TAGCCCCGTCTCTAAGGGCAGGG - Intergenic
1069069619 10:63979823-63979845 TGGCACCATCTCTGAGGAGTGGG - Intergenic
1069097383 10:64275898-64275920 TAGCAACATCTCTGACACTAAGG - Intergenic
1071290848 10:84187989-84188011 GAGCACCTTCTCTGAGGGCCAGG + Intergenic
1071786459 10:88905835-88905857 CAACACCATCTCTGAGGCTTAGG + Intronic
1072440720 10:95452343-95452365 GAGCACAGGCTCTGAGGCCATGG + Intronic
1075633557 10:124015734-124015756 TTGCAGCCTCCCTGAGGCCAGGG - Intronic
1078191492 11:9095253-9095275 CAGCATCATCCCTGAGGTCAAGG + Intronic
1083199532 11:61111828-61111850 TAGCACCAGCTCTGAGCACTAGG + Intronic
1088371175 11:109090011-109090033 TGGCACCATCTCTGGAGCTATGG - Intergenic
1089458591 11:118639877-118639899 CAGCCCCATCTCTGAGGACTCGG - Intronic
1089599269 11:119603513-119603535 CAGCATCATCGCTGAGGTCAAGG - Intergenic
1090262560 11:125331890-125331912 GAGGACCATCTCAGAGGCCCCGG + Exonic
1090903972 11:131057683-131057705 TAGCCCCTTCTCTGTAGCCATGG - Intergenic
1091356442 11:134941320-134941342 TGGCATCATCTCTGTGTCCATGG - Intergenic
1091658303 12:2362138-2362160 TAGCACAGTGTCTGTGGCCAGGG - Intronic
1095561598 12:43572232-43572254 TAGCATCATCTCAAAGGACAGGG - Intergenic
1096562872 12:52449531-52449553 CAGCATCATCGCTGAGGTCAAGG - Exonic
1096565023 12:52471194-52471216 CAGCATCATCGCTGAGGTCAAGG - Exonic
1096567035 12:52490631-52490653 CAGCATCATCGCTGAGGTCAAGG - Exonic
1096570078 12:52517652-52517674 TAGCATCATCGCTGAGGTCAAGG - Exonic
1096589499 12:52648235-52648257 TAGCATCATCGCCGAGGTCAAGG - Exonic
1098264664 12:68706405-68706427 CAGCATCATCGCTGAGGTCAAGG + Intronic
1100779246 12:98006944-98006966 TGGCACCATCTCTCAGCCCATGG - Intergenic
1102562949 12:113775844-113775866 TGCCCCCATCCCTGAGGCCAAGG + Intergenic
1102857804 12:116309695-116309717 TACCACCATTTCTGAGGAAAGGG + Intergenic
1103879988 12:124158702-124158724 CAGCATCAGCTCTGAGGGCAGGG - Intronic
1104136503 12:125944657-125944679 TAGCTCCATCTCTCAAGACAGGG - Intergenic
1105660149 13:22485078-22485100 TGGCACCATTTCTGAGGGCCCGG - Intergenic
1106443191 13:29798887-29798909 TAGCACAATTTCTGAGACCGTGG - Intronic
1109719662 13:66259871-66259893 CTGCACCATCTCTGTGGCCTTGG - Intergenic
1111558341 13:89910604-89910626 TAACACCCTCTCTGGGGCCTTGG - Intergenic
1113147199 13:107220655-107220677 CAGCACTATTTCTGATGCCAGGG - Intronic
1113553719 13:111214294-111214316 CAGCACCAGGGCTGAGGCCAGGG - Intronic
1117448730 14:55830023-55830045 TAGAACAATCACTGTGGCCAGGG + Intergenic
1117791278 14:59344533-59344555 TAGAACCATCCCTGAGGGCGGGG + Intronic
1118401797 14:65386409-65386431 TGGGAGCATCTCTGAGCCCAGGG + Intergenic
1124065938 15:26343898-26343920 CAGCACCATTCCTGAGACCAGGG + Intergenic
1125841069 15:42801621-42801643 CAGCATCATCCCTGAGGTCAAGG - Intronic
1127636164 15:60872143-60872165 GAGCTCCATGTCTGAGGCCCAGG + Intronic
1128842689 15:70863026-70863048 TTGCACCAAGTCTGAGGCCAGGG - Intronic
1129597966 15:76979659-76979681 TAGCATCATCACTGAGGTCAAGG - Intergenic
1129901415 15:79153924-79153946 AAGCACCATCTCTGAGGAACAGG - Intergenic
1132614163 16:832071-832093 GAGACCCATCTCTAAGGCCAGGG + Intergenic
1132660564 16:1059235-1059257 CAGCACTTTCTGTGAGGCCAAGG - Intergenic
1132847155 16:2005908-2005930 AGGCAGCCTCTCTGAGGCCAGGG + Intronic
1133246287 16:4451035-4451057 TAGCACGATGTCTGAGCTCAGGG - Intronic
1136654633 16:31702648-31702670 TGGGACCATCTTTGAAGCCATGG + Intergenic
1137930816 16:52585697-52585719 GAGCTCCATCTCTGTGGCAAGGG + Intergenic
1140753764 16:78049106-78049128 CAGCATCATCACTGAGGTCAGGG - Intronic
1141861273 16:86718111-86718133 CAGCCCCACCTCTCAGGCCAGGG - Intergenic
1143268127 17:5655891-5655913 TGACACCCTCTCTGAGGGCATGG - Intergenic
1143840194 17:9725710-9725732 TAGGAAAGTCTCTGAGGCCAGGG - Intronic
1145766168 17:27459587-27459609 AAGCACAGTCTCTGGGGCCACGG - Intronic
1145785421 17:27590761-27590783 TTGCACCAGCTGGGAGGCCAAGG - Intronic
1148091818 17:45026946-45026968 TAGGACCATTTCTGAGCCCCAGG - Intronic
1150837567 17:68578397-68578419 TAGCACTAGCTCACAGGCCAAGG - Intronic
1151942872 17:77303800-77303822 AAGCACCATCTCTGTCCCCAAGG + Intronic
1153572461 18:6486919-6486941 TAGCAACATCTCTCAGGCCTTGG + Intergenic
1156980845 18:43286472-43286494 TAGCTCCACCTCTGGGGGCAGGG + Intergenic
1157063595 18:44321444-44321466 CAGTATCATCTCTGAGGTCAAGG - Intergenic
1157522325 18:48353856-48353878 TAGCACCAAGACTGAGGCCCAGG + Intronic
1157525352 18:48376448-48376470 GGGCACGATGTCTGAGGCCAAGG + Intronic
1160754364 19:750006-750028 TAGCGCCGTCTATGAGGGCAGGG - Intergenic
1161234314 19:3190330-3190352 GAGAACCAGCTCTGAGGCCTGGG - Intronic
1161577030 19:5060028-5060050 TGGCAGCAGCTCTGAGGCCCTGG - Intronic
1162040640 19:7968903-7968925 TAGCTCCTTCTCTGGGGGCAAGG + Intronic
1162693711 19:12454916-12454938 TAGGACCACCTCTGACTCCAGGG + Intronic
1166819492 19:45568769-45568791 CAGCACCGTCTCTGTGGCCCAGG - Intronic
1167768631 19:51500365-51500387 CAGCAGCATCTCTGAGGCAGAGG + Intronic
924989082 2:295760-295782 TAGAATCATCTCTGAGGACAAGG + Intergenic
925479078 2:4250562-4250584 AAGCACCATCTCTGGTGCCCAGG - Intergenic
925977271 2:9150100-9150122 GAGCATGAGCTCTGAGGCCAGGG - Intergenic
929332845 2:40704810-40704832 GAGCCACATCTCTGAGGCCTTGG + Intergenic
931703599 2:64928181-64928203 TAGCACCATCTGTGTGTCTATGG - Intergenic
932571252 2:72939625-72939647 GAGCCCCACCTCTGAGGCCTGGG - Intergenic
932728721 2:74201783-74201805 TAGCATCATCTCTTTTGCCAAGG - Intronic
934951650 2:98579918-98579940 TCGCACCAGCTCTGGGGACATGG + Intronic
936093678 2:109516294-109516316 CAGCACCATCAGTGACGCCAGGG - Intergenic
936854051 2:116935531-116935553 TAACACTATCTCTTAGACCATGG + Intergenic
937127245 2:119482492-119482514 TGGAAGCATCTATGAGGCCAAGG + Intronic
937530414 2:122820646-122820668 TATCAACATCTGAGAGGCCATGG + Intergenic
938294699 2:130170808-130170830 CAGCACTTTGTCTGAGGCCAAGG + Intronic
938644008 2:133312604-133312626 TAGGACTGTCTCTGAGCCCAAGG - Intronic
939479282 2:142728397-142728419 AAGCTCCACCTCTGGGGCCAGGG + Intergenic
940048377 2:149434714-149434736 CAGAACCCTCTCTGTGGCCAGGG + Intronic
941565414 2:167099708-167099730 TAGCACCATCCCTCACGGCAGGG + Intronic
941789824 2:169539515-169539537 TCGCAGCATCTGGGAGGCCAAGG + Intronic
942326130 2:174778544-174778566 CAGCACCATCACTGGGGCGAGGG - Intergenic
942684472 2:178517131-178517153 TAGCAACACCTCTGGGGGCAAGG + Intergenic
943031131 2:182687090-182687112 AGGCTCCATCTCTGAGGGCAGGG + Intergenic
944134820 2:196387442-196387464 TAGCACCATCTGTGAGGAATAGG + Intronic
944763485 2:202840988-202841010 CAGCATCATCGCTGAGGTCAAGG - Intronic
946413977 2:219530156-219530178 CAGCACCTTCCCTGAGGGCAAGG - Intronic
947275808 2:228390850-228390872 CAGCTCCACCTCTGAGGGCAGGG - Intergenic
1168804712 20:665636-665658 TAGCACCTTCCCTGAGACCCTGG + Intronic
1169720570 20:8671872-8671894 TAGCAACTTGTCTGAGGGCACGG - Intronic
1170607890 20:17887454-17887476 TAGCACCATCTCTGAGGCCACGG + Intergenic
1171062258 20:21977342-21977364 CAGCATCATCTCTGAGGTCAGGG - Intergenic
1171135943 20:22694424-22694446 TCGTGCCATCTCTGAGGACAAGG + Intergenic
1172939386 20:38644218-38644240 AAGCCCCATCCCTGAGGCCCAGG + Intronic
1173121258 20:40291660-40291682 TAACACCATTTATGTGGCCAAGG + Intergenic
1175321558 20:58091943-58091965 TAGCACCAGCTCTGAGGAGTAGG + Intergenic
1176520265 21:7818985-7819007 TAGCAGAATCCCTGAGGACATGG - Exonic
1178654291 21:34448997-34449019 TAGCAGAATCCCTGAGGACATGG - Intergenic
1181404489 22:22673116-22673138 TAGCTCTGTCTCTGAGCCCATGG - Intergenic
1181919193 22:26306931-26306953 TATCACCATGTCTGATTCCAAGG - Intronic
1181996748 22:26888835-26888857 TAGCTCCAGCTTTGAAGCCATGG - Intergenic
1182115565 22:27754418-27754440 TCTCACCCTCTCTGAGCCCAGGG - Intronic
1182727998 22:32463795-32463817 TAGCAACATCTCTAATGACAAGG + Intronic
1183013658 22:34968477-34968499 GAGAACAAGCTCTGAGGCCATGG - Intergenic
1184864106 22:47192949-47192971 TAGCTCCATCTGTGAGACCCTGG + Intergenic
1185208016 22:49551354-49551376 TAGCATCTTCCCTGAGGCAAGGG - Intronic
1185423255 22:50747178-50747200 CAGCACCAGCTCTTAAGCCAAGG - Intergenic
949540664 3:5029573-5029595 AAGCACCATCTCAAAGGACAGGG - Intergenic
949890541 3:8730620-8730642 GAGCCCCCTCTCTGAGGCCTGGG - Intronic
950569552 3:13791718-13791740 TGGCATCATCTCTGTGGCCAAGG + Intergenic
953521762 3:43649737-43649759 TAGCACAATAGCTGAGGTCACGG - Intronic
955346739 3:58167235-58167257 AAGCAGCAGCTCTGAGGCCTGGG - Intronic
956637691 3:71382481-71382503 TACCACCCTCCCTGTGGCCAGGG - Intronic
959278161 3:104304251-104304273 TAGCACCATCCCTCACGACATGG - Intergenic
960863943 3:122181562-122181584 TAGCAGCACCTCTGTGACCATGG - Intergenic
961124895 3:124408438-124408460 CACCACCAGCTCTGAGACCATGG + Intronic
961779144 3:129311376-129311398 TAGCACCCTATCTGTCGCCAGGG - Intergenic
962407223 3:135110653-135110675 TTGCAACATCACTGAGGTCATGG - Intronic
962712848 3:138102124-138102146 CAGCATCATCGCTGAGGTCAAGG - Intronic
964380160 3:156090653-156090675 TAGCACCCTCTCTAAGGCCTAGG + Intronic
965605732 3:170496202-170496224 CAGCATCATCGCTGAGGTCAAGG + Intronic
967816992 3:193808090-193808112 AAGAAGCATCTCTGAAGCCAGGG + Intergenic
969196330 4:5566606-5566628 TAACCCAATCTCTGAGGGCAGGG - Intronic
969536237 4:7757548-7757570 TAGAACCCTCTCTGAGGTCAGGG - Intergenic
972219256 4:36935560-36935582 TAGCACCATCCCTCATGACAGGG - Intergenic
972628778 4:40825552-40825574 GGCCTCCATCTCTGAGGCCAGGG - Intronic
972829262 4:42795153-42795175 TAGCAGCATCTTTGAGGCTAGGG + Intergenic
974382017 4:61153653-61153675 TAGCAACATATAAGAGGCCAAGG + Intergenic
974846284 4:67354319-67354341 TAGCCCCGTCTCGGAGGACAGGG + Intergenic
977928711 4:102729380-102729402 CAGCATCATCGCTGAGGTCAAGG - Intronic
981509410 4:145539114-145539136 TACCACCACCTGTGAGGTCAAGG - Intronic
982443558 4:155463947-155463969 TAGCATCATTTATGAGGCGAGGG + Intergenic
983467387 4:168112041-168112063 TAGCACACTCTGGGAGGCCAAGG + Intronic
985051852 4:185999115-185999137 AGGCACCAGTTCTGAGGCCATGG + Intergenic
988143233 5:27269508-27269530 TAGCACTATCTCTGTGCACATGG - Intergenic
990503780 5:56424448-56424470 TATCACCATCACTCATGCCATGG + Intergenic
991520974 5:67496001-67496023 TAGCACCTTCTCAGAGACCATGG + Intergenic
993892656 5:93491803-93491825 TAACTCCAAGTCTGAGGCCAAGG - Intergenic
994535370 5:101023929-101023951 TAACAACATATATGAGGCCACGG + Intergenic
996315986 5:122161273-122161295 AAGCACCTGCTCTGATGCCATGG + Intronic
996512115 5:124328372-124328394 AAGCAACAGCTCTGAGGGCAAGG - Intergenic
998887210 5:146706824-146706846 CAGCATCATCGCTGAGGTCAAGG - Intronic
998926712 5:147134721-147134743 TGGTACGATCTCTGTGGCCAGGG + Intergenic
1003232248 6:4264985-4265007 GTGCACCATCTCTGAAGCCTGGG + Intergenic
1005017092 6:21384777-21384799 TAGGACCGTCTCTGGGGCCAAGG + Intergenic
1006459572 6:34150583-34150605 AAGCATCATCTCTCAGGTCAGGG - Intronic
1006459587 6:34150648-34150670 AAGCATCATCTCTCAGGTCAGGG - Intronic
1006578138 6:35060712-35060734 CTGGGCCATCTCTGAGGCCACGG - Intronic
1013430622 6:110052052-110052074 TAGCACAATGGCTGAGCCCAAGG + Intergenic
1014278785 6:119417907-119417929 TAGCACCATCTCTCACGGCATGG - Intergenic
1016440465 6:144078149-144078171 TAGCAACATTTCTGAAGCAAGGG - Intergenic
1017328529 6:153169125-153169147 GAGCAGCATCTCTGTGGCCCGGG + Intergenic
1018275860 6:162130587-162130609 TAGCACTCTCTCTGGGGACATGG + Intronic
1020792245 7:12641376-12641398 CAGCCCCATCCCTGAGGCCATGG - Intronic
1021192980 7:17643706-17643728 TGGAAGCACCTCTGAGGCCATGG - Intergenic
1022426362 7:30272393-30272415 AAGCACCATCCCAAAGGCCAGGG + Intergenic
1023289612 7:38655964-38655986 CAGCATCATCGCTGAGGTCAAGG + Intergenic
1024626430 7:51211793-51211815 TGGGATCATCCCTGAGGCCAGGG - Intronic
1025980875 7:66404786-66404808 AAGCACAAACTCTGAGGCCAAGG - Intronic
1026807883 7:73439084-73439106 GAACTCCATCTCTGAGGACAGGG - Intergenic
1027180797 7:75937972-75937994 TAGCAGCATCTCTGCGGCCTTGG - Intronic
1027269195 7:76510891-76510913 GGGCACCAGCTCTGTGGCCACGG - Exonic
1027319909 7:77004786-77004808 GGGCACCAGCTCTGTGGCCACGG - Intergenic
1028681254 7:93535767-93535789 CATCACCATCTCTTAGGCCAAGG - Intronic
1028706169 7:93849454-93849476 TAGAGCCATGTCTGAAGCCAAGG + Intronic
1030016543 7:105228627-105228649 TAACACCCTCTCTCAGGCCTCGG + Intronic
1031486605 7:122334328-122334350 TGGTACCCACTCTGAGGCCATGG + Intronic
1031861140 7:126981709-126981731 TAGCACCCTCTTAGAGGCCATGG + Intronic
1037416702 8:18659084-18659106 TCGGCCCATCTCTGAAGCCAAGG + Intronic
1037603403 8:20417857-20417879 TTGCAGCCTCCCTGAGGCCAGGG - Intergenic
1039250431 8:35658393-35658415 TTGCACCATCTTTGAAGCCAGGG + Intronic
1040282152 8:46063261-46063283 AAGCAACATCTCAGAGGACATGG + Intergenic
1040446110 8:47495306-47495328 TTGTACCATCTCAGAGGACAAGG - Intronic
1040572229 8:48621233-48621255 CAGCCCCCTCTCTGAGGCCGAGG - Intergenic
1043412474 8:80012337-80012359 TAGAACCATCTCTGAATCCTAGG + Intronic
1044019393 8:87085832-87085854 AAGTACCATCTCTGAAGCCCAGG - Intronic
1044842224 8:96346232-96346254 TATCACCAGCTCTGTGGCCCTGG - Intergenic
1045328236 8:101133206-101133228 TTGGACCACCTCTGAGGACAGGG + Intergenic
1045993087 8:108332917-108332939 TAGTACCATCTCTGAGTGTATGG - Intronic
1047102018 8:121687799-121687821 TTGCTCCATATCTGAGGACAAGG - Intergenic
1047436951 8:124842785-124842807 TAGCACCATTACTGGGACCAAGG - Intergenic
1048083285 8:131151478-131151500 TAGCATCACCCCTGAGGGCAAGG + Intergenic
1050269547 9:3927563-3927585 TACCACCATCTCTGGGGTAATGG - Intronic
1051322000 9:15914847-15914869 TAGCACCATCCCTCACGTCAGGG + Intronic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1057871387 9:98720831-98720853 TGGCACCACCTCTGGGGGCAAGG + Intergenic
1057943608 9:99305930-99305952 CAGCATCATCCCTGAGGTCAAGG + Intergenic
1059661672 9:116407714-116407736 TATCACCAACTCTGAGGCAAAGG + Intergenic
1059848161 9:118304475-118304497 TAGCAACATCTGTGGGTCCATGG + Intergenic
1203749632 Un_GL000218v1:66182-66204 GAGCCTCATCTCTGGGGCCAGGG + Intergenic
1188882860 X:35511496-35511518 TAGCACCATCTCAGTGGTAATGG + Intergenic
1189295607 X:39915379-39915401 TAACACCATCCCTGAGGGCCTGG - Intergenic
1193148238 X:78099693-78099715 CACTACCATCACTGAGGCCAAGG + Intronic
1199927224 X:152480343-152480365 AAGCATCATCGCTGAGGTCAAGG + Intergenic