ID: 1170609633

View in Genome Browser
Species Human (GRCh38)
Location 20:17902115-17902137
Sequence GGCCCTGCCCAGAACTCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170609623_1170609633 15 Left 1170609623 20:17902077-17902099 CCAAAAGGGACCCGTCGCTTTCC No data
Right 1170609633 20:17902115-17902137 GGCCCTGCCCAGAACTCTCAAGG No data
1170609632_1170609633 -10 Left 1170609632 20:17902102-17902124 CCAAGGGGGCTGTGGCCCTGCCC No data
Right 1170609633 20:17902115-17902137 GGCCCTGCCCAGAACTCTCAAGG No data
1170609622_1170609633 21 Left 1170609622 20:17902071-17902093 CCAGCACCAAAAGGGACCCGTCG No data
Right 1170609633 20:17902115-17902137 GGCCCTGCCCAGAACTCTCAAGG No data
1170609628_1170609633 4 Left 1170609628 20:17902088-17902110 CCGTCGCTTTCCAACCAAGGGGG No data
Right 1170609633 20:17902115-17902137 GGCCCTGCCCAGAACTCTCAAGG No data
1170609626_1170609633 5 Left 1170609626 20:17902087-17902109 CCCGTCGCTTTCCAACCAAGGGG No data
Right 1170609633 20:17902115-17902137 GGCCCTGCCCAGAACTCTCAAGG No data
1170609631_1170609633 -6 Left 1170609631 20:17902098-17902120 CCAACCAAGGGGGCTGTGGCCCT No data
Right 1170609633 20:17902115-17902137 GGCCCTGCCCAGAACTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170609633 Original CRISPR GGCCCTGCCCAGAACTCTCA AGG Intergenic
No off target data available for this crispr