ID: 1170611634

View in Genome Browser
Species Human (GRCh38)
Location 20:17918519-17918541
Sequence ACGCAGAAGACTGTGTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170611632_1170611634 -2 Left 1170611632 20:17918498-17918520 CCCTGGTACGGGGTATTGCTGAC No data
Right 1170611634 20:17918519-17918541 ACGCAGAAGACTGTGTGTTGTGG No data
1170611631_1170611634 1 Left 1170611631 20:17918495-17918517 CCACCCTGGTACGGGGTATTGCT No data
Right 1170611634 20:17918519-17918541 ACGCAGAAGACTGTGTGTTGTGG No data
1170611633_1170611634 -3 Left 1170611633 20:17918499-17918521 CCTGGTACGGGGTATTGCTGACG No data
Right 1170611634 20:17918519-17918541 ACGCAGAAGACTGTGTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170611634 Original CRISPR ACGCAGAAGACTGTGTGTTG TGG Intergenic
No off target data available for this crispr