ID: 1170612526

View in Genome Browser
Species Human (GRCh38)
Location 20:17926279-17926301
Sequence CCTAACACCCCAACTCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170612516_1170612526 1 Left 1170612516 20:17926255-17926277 CCCAGGAGCAACCCCCCCAAATA No data
Right 1170612526 20:17926279-17926301 CCTAACACCCCAACTCCTGAGGG No data
1170612518_1170612526 -10 Left 1170612518 20:17926266-17926288 CCCCCCCAAATAGCCTAACACCC No data
Right 1170612526 20:17926279-17926301 CCTAACACCCCAACTCCTGAGGG No data
1170612517_1170612526 0 Left 1170612517 20:17926256-17926278 CCAGGAGCAACCCCCCCAAATAG No data
Right 1170612526 20:17926279-17926301 CCTAACACCCCAACTCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170612526 Original CRISPR CCTAACACCCCAACTCCTGA GGG Intergenic
No off target data available for this crispr