ID: 1170614098

View in Genome Browser
Species Human (GRCh38)
Location 20:17935212-17935234
Sequence CTGGAACAGGTGTGGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170614091_1170614098 2 Left 1170614091 20:17935187-17935209 CCTGCGCAGGAGAGCCTGGGGTG No data
Right 1170614098 20:17935212-17935234 CTGGAACAGGTGTGGCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170614098 Original CRISPR CTGGAACAGGTGTGGCTGGA TGG Intergenic
No off target data available for this crispr