ID: 1170619970

View in Genome Browser
Species Human (GRCh38)
Location 20:17987802-17987824
Sequence TATCAAAAGGATACAGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170619970_1170619976 15 Left 1170619970 20:17987802-17987824 CCACTCTCTGTATCCTTTTGATA No data
Right 1170619976 20:17987840-17987862 TATAAACCCGACCAGGATAGGGG No data
1170619970_1170619977 19 Left 1170619970 20:17987802-17987824 CCACTCTCTGTATCCTTTTGATA No data
Right 1170619977 20:17987844-17987866 AACCCGACCAGGATAGGGGATGG No data
1170619970_1170619982 22 Left 1170619970 20:17987802-17987824 CCACTCTCTGTATCCTTTTGATA No data
Right 1170619982 20:17987847-17987869 CCGACCAGGATAGGGGATGGGGG No data
1170619970_1170619975 14 Left 1170619970 20:17987802-17987824 CCACTCTCTGTATCCTTTTGATA No data
Right 1170619975 20:17987839-17987861 GTATAAACCCGACCAGGATAGGG No data
1170619970_1170619978 20 Left 1170619970 20:17987802-17987824 CCACTCTCTGTATCCTTTTGATA No data
Right 1170619978 20:17987845-17987867 ACCCGACCAGGATAGGGGATGGG No data
1170619970_1170619973 8 Left 1170619970 20:17987802-17987824 CCACTCTCTGTATCCTTTTGATA No data
Right 1170619973 20:17987833-17987855 TGGCAAGTATAAACCCGACCAGG No data
1170619970_1170619974 13 Left 1170619970 20:17987802-17987824 CCACTCTCTGTATCCTTTTGATA No data
Right 1170619974 20:17987838-17987860 AGTATAAACCCGACCAGGATAGG No data
1170619970_1170619985 26 Left 1170619970 20:17987802-17987824 CCACTCTCTGTATCCTTTTGATA No data
Right 1170619985 20:17987851-17987873 CCAGGATAGGGGATGGGGGGAGG No data
1170619970_1170619980 21 Left 1170619970 20:17987802-17987824 CCACTCTCTGTATCCTTTTGATA No data
Right 1170619980 20:17987846-17987868 CCCGACCAGGATAGGGGATGGGG No data
1170619970_1170619983 23 Left 1170619970 20:17987802-17987824 CCACTCTCTGTATCCTTTTGATA No data
Right 1170619983 20:17987848-17987870 CGACCAGGATAGGGGATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170619970 Original CRISPR TATCAAAAGGATACAGAGAG TGG (reversed) Intronic