ID: 1170619975

View in Genome Browser
Species Human (GRCh38)
Location 20:17987839-17987861
Sequence GTATAAACCCGACCAGGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170619970_1170619975 14 Left 1170619970 20:17987802-17987824 CCACTCTCTGTATCCTTTTGATA No data
Right 1170619975 20:17987839-17987861 GTATAAACCCGACCAGGATAGGG No data
1170619972_1170619975 1 Left 1170619972 20:17987815-17987837 CCTTTTGATATTTGCATTTGGCA No data
Right 1170619975 20:17987839-17987861 GTATAAACCCGACCAGGATAGGG No data
1170619969_1170619975 26 Left 1170619969 20:17987790-17987812 CCAGTTACTGGTCCACTCTCTGT No data
Right 1170619975 20:17987839-17987861 GTATAAACCCGACCAGGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170619975 Original CRISPR GTATAAACCCGACCAGGATA GGG Intronic