ID: 1170619977

View in Genome Browser
Species Human (GRCh38)
Location 20:17987844-17987866
Sequence AACCCGACCAGGATAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170619970_1170619977 19 Left 1170619970 20:17987802-17987824 CCACTCTCTGTATCCTTTTGATA No data
Right 1170619977 20:17987844-17987866 AACCCGACCAGGATAGGGGATGG No data
1170619972_1170619977 6 Left 1170619972 20:17987815-17987837 CCTTTTGATATTTGCATTTGGCA No data
Right 1170619977 20:17987844-17987866 AACCCGACCAGGATAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170619977 Original CRISPR AACCCGACCAGGATAGGGGA TGG Intronic