ID: 1170619983 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:17987848-17987870 |
Sequence | CGACCAGGATAGGGGATGGG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1170619970_1170619983 | 23 | Left | 1170619970 | 20:17987802-17987824 | CCACTCTCTGTATCCTTTTGATA | No data | ||
Right | 1170619983 | 20:17987848-17987870 | CGACCAGGATAGGGGATGGGGGG | No data | ||||
1170619972_1170619983 | 10 | Left | 1170619972 | 20:17987815-17987837 | CCTTTTGATATTTGCATTTGGCA | No data | ||
Right | 1170619983 | 20:17987848-17987870 | CGACCAGGATAGGGGATGGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1170619983 | Original CRISPR | CGACCAGGATAGGGGATGGG GGG | Intronic | ||