ID: 1170619986

View in Genome Browser
Species Human (GRCh38)
Location 20:17987861-17987883
Sequence GGATGGGGGGAGGAATCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170619979_1170619986 -8 Left 1170619979 20:17987846-17987868 CCCGACCAGGATAGGGGATGGGG No data
Right 1170619986 20:17987861-17987883 GGATGGGGGGAGGAATCCACTGG No data
1170619972_1170619986 23 Left 1170619972 20:17987815-17987837 CCTTTTGATATTTGCATTTGGCA No data
Right 1170619986 20:17987861-17987883 GGATGGGGGGAGGAATCCACTGG No data
1170619981_1170619986 -9 Left 1170619981 20:17987847-17987869 CCGACCAGGATAGGGGATGGGGG No data
Right 1170619986 20:17987861-17987883 GGATGGGGGGAGGAATCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170619986 Original CRISPR GGATGGGGGGAGGAATCCAC TGG Intronic