ID: 1170621063

View in Genome Browser
Species Human (GRCh38)
Location 20:17996499-17996521
Sequence ATGCATCTGGGTCACCGGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 53}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170621052_1170621063 14 Left 1170621052 20:17996462-17996484 CCTGGCTACACAGCCCAGTGAGG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1170621063 20:17996499-17996521 ATGCATCTGGGTCACCGGTTCGG 0: 1
1: 0
2: 0
3: 6
4: 53
1170621055_1170621063 0 Left 1170621055 20:17996476-17996498 CCAGTGAGGCCCCTTGCTACCAA 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1170621063 20:17996499-17996521 ATGCATCTGGGTCACCGGTTCGG 0: 1
1: 0
2: 0
3: 6
4: 53
1170621057_1170621063 -10 Left 1170621057 20:17996486-17996508 CCCTTGCTACCAAATGCATCTGG 0: 1
1: 0
2: 1
3: 6
4: 113
Right 1170621063 20:17996499-17996521 ATGCATCTGGGTCACCGGTTCGG 0: 1
1: 0
2: 0
3: 6
4: 53
1170621054_1170621063 1 Left 1170621054 20:17996475-17996497 CCCAGTGAGGCCCCTTGCTACCA 0: 1
1: 0
2: 1
3: 15
4: 131
Right 1170621063 20:17996499-17996521 ATGCATCTGGGTCACCGGTTCGG 0: 1
1: 0
2: 0
3: 6
4: 53
1170621056_1170621063 -9 Left 1170621056 20:17996485-17996507 CCCCTTGCTACCAAATGCATCTG 0: 1
1: 0
2: 1
3: 10
4: 149
Right 1170621063 20:17996499-17996521 ATGCATCTGGGTCACCGGTTCGG 0: 1
1: 0
2: 0
3: 6
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170621063 Original CRISPR ATGCATCTGGGTCACCGGTT CGG Intronic
908533636 1:65057042-65057064 AAGCATATGGGTCACTGCTTTGG + Intergenic
916807039 1:168269343-168269365 CTGCATGTGGGTCACCCATTGGG + Intergenic
1064465268 10:15573533-15573555 CTGAATCTGGGCCACAGGTTGGG + Intronic
1070495355 10:77016274-77016296 ATGCAACTGGGTCACTGATTTGG - Intronic
1076224156 10:128759983-128760005 ATGTATCTGGGGTACCGGTGTGG - Intergenic
1079793995 11:24775733-24775755 TTGCATCTGGGTCACTTTTTCGG + Intronic
1080447661 11:32352301-32352323 ATGCACGTGAGTCACCGGTGGGG + Intergenic
1085517885 11:77121990-77122012 ATGTACCTGGGTCACCAGCTGGG - Exonic
1098994254 12:77099768-77099790 ATGAATCTGGGTCCCCGGATAGG - Intergenic
1104091281 12:125519934-125519956 ATGCATCAGGGTTACACGTTGGG + Intronic
1117189667 14:53277723-53277745 CTGCATGTGGGTCACCTGCTGGG + Intergenic
1120215130 14:81673677-81673699 ATGCATCTAGTTCAACTGTTTGG - Intergenic
1121063761 14:90941250-90941272 ATGCTTCTGTGGCACCGGGTGGG + Intronic
1130043262 15:80424032-80424054 ATGCAACTGGGCCACCACTTGGG - Intronic
1130624705 15:85502028-85502050 ATGCATTTGGGTCACCAGGAGGG + Intronic
1134405357 16:13953557-13953579 ATGCCTCTTGGTCACTGATTAGG + Intergenic
1137807968 16:51325504-51325526 AGGCATCTGGGTCTCTGGTATGG - Intergenic
1142833047 17:2563482-2563504 ATGAATCTGGATCAGCGATTTGG - Intergenic
1153935076 18:9914104-9914126 CTGCCGCTGTGTCACCGGTTCGG - Exonic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161760909 19:6171844-6171866 ATGCATTTAAGTCACAGGTTTGG + Intronic
1167950146 19:53019830-53019852 ATGCAGCTGGGTCAGGGGCTGGG - Intergenic
925229624 2:2221426-2221448 ATGCATCTGAGGCCCCAGTTTGG + Intronic
925855248 2:8123300-8123322 AAGCAACTGGGTCACTGGTTTGG - Intergenic
927651447 2:24915948-24915970 AAGCTTCTGAGTCACTGGTTTGG - Intronic
933829403 2:86195019-86195041 TGGCGTCTGGGTCGCCGGTTGGG - Intronic
935952818 2:108346279-108346301 TTACATCTGGGTCACAGGTTTGG + Intergenic
1169221805 20:3827600-3827622 ATGTATGTGGGTCACTGATTGGG + Exonic
1170284597 20:14692317-14692339 ATCCATTTGGGTCACAGATTAGG + Intronic
1170621063 20:17996499-17996521 ATGCATCTGGGTCACCGGTTCGG + Intronic
1170705293 20:18738895-18738917 GTGCATATGTGTCACCTGTTAGG - Intronic
1179107393 21:38414753-38414775 ATGCTTCTGGGACACCTGTCAGG - Intronic
961063685 3:123855729-123855751 ATGCTTCTGGGGCACCAGTTAGG - Intronic
962283979 3:134071576-134071598 TTTCATCAGGGTCACAGGTTAGG - Intronic
963372069 3:144412963-144412985 ATGTATCTAGGTCAGCGGATGGG + Intergenic
967641754 3:191873841-191873863 ATGCATCAGAGTCACCTGATCGG - Intergenic
969871299 4:10106745-10106767 ATACAACTGGGTCAGCGGTGGGG + Intronic
984316531 4:178138023-178138045 CTGCATGTGAGTCACCTGTTGGG - Intergenic
985182754 4:187282562-187282584 ATGTCTCTGGGTCACCTCTTCGG + Intergenic
985649950 5:1102799-1102821 ATGCCACTGGGTCACCAGGTGGG - Intronic
986651381 5:9966568-9966590 ATGCATCAGGGTCACCTGGAGGG + Intergenic
987631465 5:20478246-20478268 ATGCAGCTGGGACACCAGCTTGG + Intronic
992393535 5:76351064-76351086 ATGCATCTGCATCACTGGGTCGG + Intronic
1002273843 5:178090855-178090877 AAGTATCTGGGTCACCTCTTGGG - Intergenic
1004160078 6:13205314-13205336 AGGCATTTGGGTCACGGGTGTGG - Intronic
1006635002 6:35455870-35455892 AGGCATCTGGGTCAGGGGCTAGG - Exonic
1012155570 6:95815572-95815594 ATGCCACTGGGTCACTGGTTTGG - Intergenic
1018848595 6:167572160-167572182 GTTCATCTGGGTAACCGGGTGGG - Intergenic
1021592426 7:22278157-22278179 ATGAATTTGGGGCACTGGTTGGG - Intronic
1027140105 7:75650744-75650766 ATGCTTCTGGGACACTGCTTTGG - Intronic
1030484790 7:110151817-110151839 CTGCATCTGACTCCCCGGTTTGG - Intergenic
1042066608 8:64884000-64884022 TTGCATCTGAGTCTCAGGTTTGG + Intergenic
1042746927 8:72118688-72118710 AGGCAGATGGGTTACCGGTTTGG + Intergenic
1047529594 8:125663126-125663148 TTGAATGTGGGTCACCAGTTAGG - Intergenic
1049135758 8:140897594-140897616 TGGCATCTGGGTCACCTCTTTGG + Intronic
1049676607 8:143892030-143892052 AGGCTTCTGGGTCACGGGGTGGG - Intergenic
1055829233 9:80359810-80359832 ATGCATCTGCGTCACTGTTCTGG + Intergenic
1058006258 9:99918685-99918707 ATGCATGTGGGTAGCAGGTTAGG + Intronic
1059896937 9:118876836-118876858 ATGCATCTGATTCGCCTGTTTGG - Intergenic
1199698215 X:150358662-150358684 ATGCACCTGGGTCTCCTGCTTGG - Intergenic