ID: 1170621160

View in Genome Browser
Species Human (GRCh38)
Location 20:17997455-17997477
Sequence ATGGCTGAACAAAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 505}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170621160_1170621166 -3 Left 1170621160 20:17997455-17997477 CCTTCCTCCCTTTGTTCAGCCAT 0: 1
1: 0
2: 1
3: 48
4: 505
Right 1170621166 20:17997475-17997497 CATATCTTGCCTGAGAGCTTGGG 0: 1
1: 0
2: 1
3: 21
4: 205
1170621160_1170621165 -4 Left 1170621160 20:17997455-17997477 CCTTCCTCCCTTTGTTCAGCCAT 0: 1
1: 0
2: 1
3: 48
4: 505
Right 1170621165 20:17997474-17997496 CCATATCTTGCCTGAGAGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170621160 Original CRISPR ATGGCTGAACAAAGGGAGGA AGG (reversed) Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
901001297 1:6150140-6150162 ATGGGTGGACAAATGGATGATGG + Intronic
901001300 1:6150159-6150181 ATGGATGGACAAATGGATGATGG + Intronic
901001319 1:6150278-6150300 ATGGATGGACAAATGGATGATGG + Intronic
901444105 1:9296804-9296826 TTGCTTGGACAAAGGGAGGATGG + Intronic
902259318 1:15212657-15212679 ATGGCTGGCAAAAGGAAGGATGG - Intronic
902738606 1:18418371-18418393 ATGGAAGAAGAAAGGAAGGAAGG + Intergenic
902780051 1:18699076-18699098 ATGAATGAACAAGGGGAGGCAGG - Intronic
902789207 1:18753991-18754013 CTGGCTTCACAAAAGGAGGAAGG - Intergenic
903125108 1:21242497-21242519 TGGGCTGAACACAAGGAGGAGGG + Intronic
903273329 1:22205726-22205748 ATGAATGAACAAAAGGTGGAAGG - Intergenic
903363213 1:22790140-22790162 ATGGGTGAAGGTAGGGAGGAAGG + Intronic
903610507 1:24608311-24608333 TGGGCTGAACAAGGGGAGTACGG + Exonic
904956983 1:34292795-34292817 ATGGATGAACAAATGGATGTGGG + Intergenic
905313580 1:37066894-37066916 ATGTCAAAACAAAGGGAGGAAGG - Intergenic
906107367 1:43302835-43302857 AGGGCTGAACAAAGGCAGGCTGG + Intronic
906835342 1:49077813-49077835 AAAGATGACCAAAGGGAGGAGGG + Intronic
907838910 1:58137605-58137627 ATGGTTGAATAAATGGGGGATGG - Intronic
907955190 1:59221557-59221579 ATGGCTGAATAAATGCAGGCAGG - Intergenic
909290328 1:73874888-73874910 ATGACAGAACAAAGGGAAAAGGG + Intergenic
909421357 1:75469960-75469982 ATTGCAGTTCAAAGGGAGGAGGG + Intronic
911378063 1:97075945-97075967 TTGGTTGAACAAAAGGATGAAGG + Intergenic
911462263 1:98205865-98205887 AGGACGGAACAAAGGAAGGAAGG + Intergenic
912430039 1:109624153-109624175 AAAGCTGGACAAAGGGAAGAGGG - Intronic
912859000 1:113196337-113196359 ATAGCTGAACACATGGAGGGTGG + Intergenic
913080249 1:115378088-115378110 CTTGCTTAACAAAGGGATGAGGG + Intergenic
913190331 1:116407962-116407984 ATGGCAGAAGAAAGGGTGTATGG - Intronic
913329412 1:117654659-117654681 AAGGCTGAAAACAGGCAGGAAGG + Intergenic
913329709 1:117657066-117657088 ATGAATGAATAAAGGAAGGAAGG - Intergenic
913428148 1:118757863-118757885 ATGGATGAAGGAAGGGAGGATGG + Intergenic
913481313 1:119291971-119291993 AAGGAAGAACAAAGGAAGGAAGG - Intergenic
913964410 1:143363506-143363528 ATGGATGAACACAGGAAGAAAGG + Intergenic
914058779 1:144189112-144189134 ATGGATGAACACAGGAAGAAAGG + Intergenic
914120370 1:144777259-144777281 ATGGATGAACACAGGAAGAAAGG - Intergenic
914425146 1:147569135-147569157 ATGGGTGAACAAATGGACAAAGG + Intronic
915025793 1:152828211-152828233 ATGGCTAAAGATATGGAGGAGGG + Intergenic
916149757 1:161775504-161775526 ATCACGGAACAAAGGAAGGAAGG - Intronic
916575786 1:166065153-166065175 GTGGCTGGACAAGTGGAGGAGGG + Intronic
917010990 1:170470673-170470695 TTGGCAGAAAAAAGTGAGGAGGG + Intergenic
918178843 1:182068971-182068993 AGGGAGGAACAAAGGAAGGAAGG + Intergenic
918484583 1:185015900-185015922 ATGGCTGAATAAAGAAAAGAGGG - Intergenic
918633932 1:186752207-186752229 ATGGGTGAACAAAATGATGATGG - Intergenic
922030951 1:221797648-221797670 ATGAATGAAGACAGGGAGGATGG + Intergenic
922815615 1:228446738-228446760 ATAGCTTAACAAAGGGCGGGAGG - Intergenic
923848765 1:237768869-237768891 ATCGCAGAACAATGGGAAGAGGG - Intronic
924923654 1:248657681-248657703 AGGGCTGAGCGAAGGGAGGGAGG + Intergenic
1063915118 10:10873819-10873841 AAGGCTGGACAAAGGGGTGAAGG - Intergenic
1064363577 10:14687327-14687349 ACAGCTGAAATAAGGGAGGAAGG + Intronic
1064543619 10:16429643-16429665 ACAGATGAACAAAGAGAGGAAGG + Intergenic
1064652108 10:17519680-17519702 ATGGAGGAAGAAAGGAAGGAAGG + Intergenic
1066221041 10:33336204-33336226 ATAGCTGGCCAAAGGGAGGTAGG + Exonic
1066656348 10:37702229-37702251 CTGGCTGAGGACAGGGAGGAGGG - Intergenic
1067292099 10:44950887-44950909 ATGGCTGGCCAAGGGGAGGAAGG - Intergenic
1067644840 10:48088249-48088271 ATGTCTGTACAGAGGGATGAGGG - Intergenic
1068948662 10:62755351-62755373 AAGGAGGAAGAAAGGGAGGAGGG + Intergenic
1069984691 10:72275085-72275107 CTGGCTGAAGCCAGGGAGGAAGG - Exonic
1070415014 10:76181162-76181184 ATGTCTGCAAAAAGGGAGAAGGG - Intronic
1070566307 10:77606096-77606118 AGGGCTGCACCAAGGGTGGATGG - Intronic
1071106333 10:82100364-82100386 AAGGCTGAAAAAAAGGAAGAGGG - Intronic
1072152774 10:92696498-92696520 ATGGCTGAGCAGAGGGCGCAGGG + Intergenic
1072686054 10:97537616-97537638 AGGTCTGAAAAGAGGGAGGAGGG + Intronic
1072815784 10:98507739-98507761 AAGGAGGAACAAAGGGAGGAAGG - Intronic
1073251227 10:102121246-102121268 AAGGCTGGAGAAAGGGGGGAAGG - Intergenic
1073349723 10:102810969-102810991 ATGGATGAATGAAGGGAGGGAGG - Intronic
1073527108 10:104193971-104193993 ACGGCTGCAGAGAGGGAGGATGG + Exonic
1074365911 10:112857354-112857376 ATTGATGAACAAATGAAGGAAGG - Intergenic
1074431899 10:113401488-113401510 ATAACAGAACAAAGGGTGGAGGG - Intergenic
1075440796 10:122477919-122477941 ATGGCAGAAGGAAGGGAGGCTGG + Intronic
1075998376 10:126896001-126896023 ATGTCTAAAGAAAGGAAGGAAGG - Intergenic
1076345557 10:129776534-129776556 AGGGAGGAACAAAGGAAGGAAGG + Intergenic
1076558721 10:131347062-131347084 AAGGAAGAAGAAAGGGAGGAAGG - Intergenic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077480934 11:2814252-2814274 AGGGCTGAATAAAGGATGGATGG + Intronic
1077664798 11:4098289-4098311 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1077733845 11:4766720-4766742 AAGGATGAAAAAAGGAAGGAAGG - Intronic
1078470490 11:11582142-11582164 AGGGCTGAACAAAGTGAAGAGGG + Intronic
1078662701 11:13299844-13299866 AATGCTGAGCAAAGGCAGGAGGG - Intronic
1079085304 11:17440746-17440768 CTAGCTGGACAAAGGGAGGTTGG + Intronic
1080135039 11:28844624-28844646 AGGGAAGAAGAAAGGGAGGAAGG - Intergenic
1080864181 11:36178800-36178822 ATGGATGTTCAAAGGCAGGAGGG - Intronic
1081576733 11:44323346-44323368 ATGAATGAAGAAAGGAAGGAAGG + Intergenic
1081626439 11:44658804-44658826 AGGGCTGAGCAGAGGGAGGGAGG + Intergenic
1081720896 11:45287389-45287411 ATAGCTGAAAAACTGGAGGACGG - Intergenic
1083145576 11:60755907-60755929 ATTGGTGAACAAAGGGGGCAAGG - Intergenic
1083248491 11:61449087-61449109 GTGGCTAGACAAAGAGAGGAAGG + Intronic
1083734215 11:64670415-64670437 AGGGCTGGAGAAAGGGAAGAAGG + Intronic
1084605288 11:70168597-70168619 ATGGATGAACAAAGGCAGTCAGG + Intronic
1085403474 11:76248104-76248126 AGGGCTGAGCTAAGGGAGGAGGG - Intergenic
1085696066 11:78705699-78705721 ATGAATGAACGAAGGAAGGAAGG + Intronic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086847422 11:91768689-91768711 AGGGATGGAAAAAGGGAGGAAGG + Intergenic
1087179999 11:95132316-95132338 ATGACTGAATAAATGAAGGATGG - Exonic
1087346544 11:96978827-96978849 ATGGCTGAACAAAGAAAGTGTGG - Intergenic
1087735329 11:101826437-101826459 CTGGCTGAACAAAGGATGGAAGG + Intronic
1088357597 11:108960076-108960098 ATGGCTGACCACAGTGGGGACGG + Intergenic
1088868054 11:113867828-113867850 AGGGAGGAAGAAAGGGAGGAAGG + Intronic
1089166403 11:116480622-116480644 ATGGATGAACAGTGGGAAGATGG + Intergenic
1089330304 11:117684867-117684889 ATTGCTCCACAGAGGGAGGAAGG + Intronic
1090475078 11:127013017-127013039 ATAACGGAAGAAAGGGAGGAAGG + Intergenic
1090880244 11:130826444-130826466 ATGAATGAATAAAGGGATGAAGG - Intergenic
1091142804 11:133250481-133250503 AAGAATGAAGAAAGGGAGGAAGG + Intronic
1092191944 12:6527684-6527706 TTGCATGAACAAAGTGAGGAAGG - Intronic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093429446 12:19067700-19067722 ATGAATGAATAAAGGAAGGAGGG + Intergenic
1094480015 12:30874287-30874309 ATGGTTGATAAAAGGGAGAATGG + Intergenic
1096760176 12:53835195-53835217 ATGGATAAACTAAGAGAGGAGGG - Intergenic
1096815793 12:54200993-54201015 AAGGCTGAACAAAGGGAAGTTGG - Intergenic
1097560600 12:61200357-61200379 ATGGCAGAACAAAGAGAAGAAGG - Intergenic
1099474587 12:83092856-83092878 AAAGCTGAACAAAAGCAGGAAGG + Intronic
1099941327 12:89192746-89192768 GTGGCTCAGCAGAGGGAGGAAGG + Intergenic
1100001559 12:89843089-89843111 ATTGCAGAAGAAAGGGAGAATGG + Intergenic
1101231611 12:102747178-102747200 ATTGTTGAATAAAGGGATGAAGG + Intergenic
1101821229 12:108185718-108185740 ATGGCAGAGAACAGGGAGGAAGG - Intronic
1101864763 12:108512540-108512562 AAGACTTAACAAAGAGAGGAGGG + Intergenic
1102426241 12:112846511-112846533 ATGGCAGAAGATGGGGAGGAGGG + Intronic
1102436393 12:112927436-112927458 ATGGCTGAGAATAGGGAGGGAGG - Intronic
1102496208 12:113321009-113321031 CTGGCTTATCAATGGGAGGAGGG - Intronic
1102517210 12:113457716-113457738 ATGGAGGAGGAAAGGGAGGAGGG + Intergenic
1103065103 12:117891021-117891043 ATGGCAGAATAAAGGCAGTAGGG + Intronic
1103199162 12:119072429-119072451 AAGGATGAAGAAAGGGAGCAGGG + Intronic
1104569496 12:129912568-129912590 AAGACGGAACAAAGGAAGGAAGG + Intergenic
1105641984 13:22275241-22275263 ATGGAGGAAGAAAGGAAGGAAGG - Intergenic
1106343978 13:28858450-28858472 GTGGATGAAGAATGGGAGGAAGG - Intronic
1110228403 13:73143600-73143622 ATGGGTGAACAAGAGGAGGAAGG - Intergenic
1110367478 13:74703073-74703095 ATGGATGAACGAATGAAGGAAGG + Intergenic
1111065234 13:83082472-83082494 ATGGCTAAACTTAGTGAGGAAGG - Intergenic
1111399217 13:87710211-87710233 ATGACAGAAGAAAGGAAGGACGG - Intergenic
1111674855 13:91374797-91374819 ATGGAGGAAGAAAGGGAGAATGG + Intergenic
1112965390 13:105185416-105185438 TTGACTGTACAATGGGAGGAAGG - Intergenic
1113072948 13:106439011-106439033 ATGGATGGATGAAGGGAGGAAGG + Intergenic
1113224736 13:108147356-108147378 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224762 13:108147503-108147525 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224791 13:108147699-108147721 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224811 13:108147797-108147819 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224832 13:108147894-108147916 ATGGCTGAATAGATGGAAGATGG - Intergenic
1113224840 13:108147943-108147965 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224862 13:108148040-108148062 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224873 13:108148089-108148111 ATGACTGAATAGATGGAGGATGG - Intergenic
1115643049 14:35347568-35347590 GTGGGAGATCAAAGGGAGGAGGG + Intergenic
1115909610 14:38240902-38240924 ATGGCTGGAGAGAGGGAGAATGG + Intergenic
1117103074 14:52370284-52370306 TTGGCTGGACCAAGGGTGGAAGG + Intergenic
1117212378 14:53513908-53513930 ATGTGTGAACAAAGGCAGTACGG + Intergenic
1117916150 14:60680205-60680227 ATTGCTGAACCAAGAAAGGATGG - Intergenic
1117941240 14:60967776-60967798 ATAGCTAAACAAATGGAAGAGGG - Intronic
1118438558 14:65792694-65792716 TTGGCTGACCAGAGGGAGAAGGG + Intergenic
1118778478 14:68989686-68989708 ATGATGGAAAAAAGGGAGGAAGG - Intergenic
1120287125 14:82518104-82518126 AAGGATGAAGAAAGGAAGGAAGG + Intergenic
1120545566 14:85807463-85807485 ATGGATGACCAAAGTGAGCAAGG - Intergenic
1121012941 14:90532756-90532778 GTGGCTGAACACAGGCAGGAAGG + Exonic
1121599248 14:95190967-95190989 ATGGCAGAATCCAGGGAGGAAGG - Exonic
1123415703 15:20093490-20093512 AGGCCTGAACACAGGCAGGAAGG + Intergenic
1123470490 15:20548366-20548388 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1123525042 15:21100604-21100626 AGGCCTGAACACAGGCAGGAAGG + Intergenic
1123647569 15:22452334-22452356 AAGGAAGAAGAAAGGGAGGAAGG - Intergenic
1123730789 15:23143344-23143366 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1123748928 15:23340770-23340792 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1124281300 15:28364653-28364675 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1124301402 15:28546968-28546990 AAGGAAGAAGAAAGGGAGGAAGG - Intergenic
1125920568 15:43523109-43523131 CTGGCTGAACAAAGGGACACAGG + Exonic
1127367503 15:58305378-58305400 ATGGCAGGACAAAGGGGGCATGG - Intronic
1128085306 15:64882384-64882406 GTGGCTAAACGAAGGGAGGGAGG - Intronic
1128793679 15:70450087-70450109 ATGGGTGGACAGAGGGATGAGGG + Intergenic
1130554433 15:84912964-84912986 ATGGCTGAAAGAAGGGAGATGGG + Intronic
1130885645 15:88090369-88090391 AATGCTGAAGAAAGGAAGGAAGG + Intronic
1131396426 15:92090472-92090494 ATGGCTGGACAAGGGGACAAGGG - Intronic
1132356373 15:101174195-101174217 ATGGCTGAAGAAGAGGAGAAGGG - Intergenic
1132650295 16:1018510-1018532 ATGGCTGAGCCCAGGGAGGTTGG - Intergenic
1132799929 16:1747004-1747026 AAGGCCAAACACAGGGAGGAGGG - Intronic
1133146534 16:3791211-3791233 ATGGTTGAAAAACGGGAGGGAGG + Intronic
1133711714 16:8408084-8408106 ATGGAGGAATAAAGGAAGGAAGG - Intergenic
1134125780 16:11615072-11615094 ATGAATGAACAAAGGAAGGAAGG + Intronic
1134881318 16:17747340-17747362 GTGGCACAACAAAGGAAGGAAGG + Intergenic
1137942859 16:52705802-52705824 ATGGATGAACAAAAGAAGGTAGG + Intergenic
1137977316 16:53042514-53042536 AAAGATGAAGAAAGGGAGGAGGG - Intergenic
1138010158 16:53371992-53372014 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1138194090 16:55039967-55039989 ATGGCTGGACAGAGGCAAGAGGG - Intergenic
1138630085 16:58286789-58286811 AGGGCTGATGAAAGGAAGGATGG + Intronic
1138631230 16:58295629-58295651 ATGGCTGATGGAAGGCAGGAAGG + Intronic
1138795247 16:59960037-59960059 ATGGATGAATAAAGGATGGATGG + Intergenic
1138795252 16:59960076-59960098 ATGGATGAATAAAGGATGGATGG + Intergenic
1138996121 16:62455025-62455047 AGGGCAGGACCAAGGGAGGAGGG - Intergenic
1139197094 16:64932233-64932255 AGGGATGAATAAAGTGAGGAGGG - Intergenic
1139253521 16:65519521-65519543 AGGAAGGAACAAAGGGAGGAGGG - Intergenic
1139630742 16:68230618-68230640 AAGGCAGAAACAAGGGAGGAGGG - Intronic
1139750468 16:69106534-69106556 ATGCAGGAAGAAAGGGAGGAGGG - Intronic
1140018678 16:71215247-71215269 AAGGAGGAAGAAAGGGAGGAAGG + Intronic
1141155545 16:81594120-81594142 TTGTCTCAAAAAAGGGAGGAGGG - Intronic
1141475842 16:84272772-84272794 ATGGATGAATGATGGGAGGATGG - Intergenic
1141868313 16:86766362-86766384 ATGGCATAACAAAGGAATGAGGG + Intergenic
1143125847 17:4640537-4640559 AGGGAGGAAAAAAGGGAGGAGGG + Intronic
1143212138 17:5196262-5196284 ATAGCTGATCACATGGAGGATGG - Intergenic
1143402631 17:6656285-6656307 AGGGAGGAAAAAAGGGAGGAGGG - Intergenic
1143628418 17:8123729-8123751 AGGGCAGAGCCAAGGGAGGAGGG - Intronic
1143888920 17:10087521-10087543 ATGAATGAAGAAAGGAAGGAAGG + Intronic
1144512993 17:15893505-15893527 AGGGAGGAAGAAAGGGAGGAGGG - Intergenic
1144941665 17:18946508-18946530 ATGGCTGAACACGTGGAGGCAGG - Intergenic
1145228694 17:21153729-21153751 ATGGGTGAAAAAAAGGGGGAAGG + Intronic
1145262283 17:21361511-21361533 GTGGCTGAACAGAGGGAGCGGGG - Intergenic
1147142590 17:38467737-38467759 ATGAATGAACAAAAGAAGGAGGG - Intronic
1148326464 17:46786101-46786123 AAGCCTGGAAAAAGGGAGGAGGG + Intronic
1149053782 17:52338083-52338105 ATGTCTGAACTAATGCAGGAGGG - Intergenic
1149129227 17:53276237-53276259 TTAGCTGGGCAAAGGGAGGAAGG - Intergenic
1149374630 17:56031697-56031719 ATGGCTGAGTAAAATGAGGAAGG + Intergenic
1149413978 17:56439007-56439029 ATGGTTGCACAAAGTAAGGAAGG + Intronic
1150815039 17:68386210-68386232 AGGGCAGAACACAGAGAGGAAGG - Intronic
1151353782 17:73546554-73546576 CTGGCTGACCAGAGGGAGCAAGG + Intronic
1153395380 18:4614318-4614340 ATGACTGAACTTAGTGAGGAAGG - Intergenic
1153671239 18:7414533-7414555 CTGGCAGAGCACAGGGAGGAGGG + Intergenic
1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG + Intergenic
1154102718 18:11490751-11490773 GTGGCTGAAAAAAGTCAGGAAGG - Intergenic
1154974970 18:21448523-21448545 ATGGAAGAACAAAGGGGTGATGG - Intronic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155519259 18:26652719-26652741 ATTGTTGAACAAATGGAGGGAGG + Intronic
1155829249 18:30492246-30492268 AGGGAGGAAGAAAGGGAGGAAGG + Intergenic
1155937482 18:31768662-31768684 ATTGATGAAGAAAGGAAGGAAGG - Intergenic
1156144580 18:34159753-34159775 AGGGCAGAAAAAAGGGAGAAAGG - Intronic
1156428074 18:37037798-37037820 ATGGTTGAGAAAAGGGAAGATGG + Intronic
1157340186 18:46771409-46771431 AAGGCTGATGAGAGGGAGGATGG - Intergenic
1158346481 18:56521512-56521534 GTTGCTGAACACAGGGAGGGAGG - Intergenic
1158500605 18:57997361-57997383 CTGGCTTAAGAAATGGAGGAAGG - Intergenic
1158689834 18:59650375-59650397 ATGGAGGAACCTAGGGAGGAAGG - Intronic
1158930634 18:62322454-62322476 ATGGTAGCACAAAGGGAGGGAGG + Intergenic
1159012356 18:63069923-63069945 TTGTCTGAAGATAGGGAGGAGGG - Intergenic
1161157281 19:2739218-2739240 CTGGCTGAACACATGGACGAGGG + Intronic
1161199188 19:3005169-3005191 ATGGCTGGACAAAAGCAGGTGGG + Intronic
1161258541 19:3322999-3323021 ATAGATGGACAAAGGGATGAAGG + Intergenic
1161567083 19:5009219-5009241 ATGGCTCAATAAAGGAAGCAGGG - Intronic
1161709697 19:5841157-5841179 ATCGCTGGGCAAAGGGAGGGTGG + Intergenic
1162658879 19:12154138-12154160 ATGCCTGAACAGAGCCAGGAAGG + Intronic
1162671468 19:12261092-12261114 ATGGCTTAAAAAAGCAAGGAAGG + Intronic
1162743114 19:12784125-12784147 CTGGCTGGACAGACGGAGGAGGG + Intronic
1163383608 19:16985546-16985568 ATGGGTGGAGAAAGGAAGGAAGG + Intronic
1163596143 19:18222070-18222092 ATAGAGGAACAAAGGAAGGAGGG + Intronic
1164477856 19:28589046-28589068 AGGGATGAAAAAAGGGGGGAGGG + Intergenic
1164802699 19:31090799-31090821 ATGGCGGAAGAAAGAGAGGAAGG + Intergenic
1165020447 19:32920010-32920032 ATGAATGAAGGAAGGGAGGAAGG - Intronic
1165654385 19:37520540-37520562 ATGGCTAAATGAAGGGAGGATGG + Intronic
1166318373 19:42001635-42001657 AAGGCTCAACAAAGGGTGGAGGG - Intronic
1167158996 19:47755587-47755609 GTTCCTGAACAAAGGCAGGAAGG - Intronic
1167277633 19:48548480-48548502 ATGGCTGAATGAATGCAGGATGG + Intergenic
1168428303 19:56257310-56257332 CTGGGAGAACAAAGGGAGGCAGG + Intronic
1168505673 19:56932805-56932827 AGGTCGGAACAAAGGGAGGGAGG - Intergenic
1168714473 19:58518943-58518965 CTGGCTGAGCAAAGGGACGGCGG - Intronic
1202698182 1_KI270712v1_random:140997-141019 ATGGATGAACATAGGAAGAAAGG + Intergenic
925324470 2:3007187-3007209 AGTGTTGAACAAAGGGAAGAAGG - Intergenic
925606638 2:5666945-5666967 AGGGCTGAGCAGGGGGAGGAGGG - Intergenic
926190933 2:10727072-10727094 CTGTCTCAAAAAAGGGAGGAAGG - Intronic
926455158 2:13058192-13058214 ATTGATAAACAAAAGGAGGAAGG - Intergenic
927103267 2:19804204-19804226 ATGGATGATTAAAGGAAGGAGGG + Intergenic
927377573 2:22436102-22436124 GTGTTTGAACAAAGGAAGGAAGG + Intergenic
927566256 2:24115941-24115963 ATGGCTGGGCAAAGGGAACAGGG + Intronic
927573723 2:24182863-24182885 ATGGCTGAACTGAGGGAGGGAGG - Intronic
927708078 2:25309259-25309281 ATGTCTGAAGAAAGGGAGGGAGG + Intronic
928283432 2:29968550-29968572 ATGGCTGGCCAAAGAGAAGAAGG + Intergenic
929465843 2:42143081-42143103 GTGGCCCAAGAAAGGGAGGACGG - Intergenic
929591536 2:43150671-43150693 AGGGGTGCACAGAGGGAGGAAGG - Intergenic
929791106 2:45023792-45023814 ATGGCTGGGCAAAGGAAGGGAGG - Intergenic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
931569667 2:63655289-63655311 ATGGCTGGAGAAAGGGAAGGGGG - Intronic
933180369 2:79219904-79219926 ATAGCAGAACAAAGGAAGAAAGG - Intronic
934279437 2:91598780-91598802 ATGGATGAACACAGGAAGAAAGG + Intergenic
935787145 2:106559572-106559594 ACGGATGAACGAAGGGAGGAAGG - Intergenic
935889194 2:107657572-107657594 ATGACTGAAGAAAGGAAGGAAGG + Intergenic
936868622 2:117107376-117107398 ATGGCTGAACATTGGAGGGAAGG + Intergenic
937486499 2:122320671-122320693 ATGACTAGACAAAGGAAGGAAGG - Intergenic
937555734 2:123152815-123152837 ATGGATGAAGGAAGGAAGGAAGG - Intergenic
937626308 2:124047746-124047768 AGAGCTGAAAAAAGAGAGGAGGG - Intronic
938020629 2:127903079-127903101 ATGGCTGAATAAAGTGATGGAGG - Intergenic
938201428 2:129376026-129376048 AAGGCTGAACACAGGGCTGAGGG - Intergenic
940139952 2:150483040-150483062 ATGGATGGAGAAAGGGAGAAAGG + Intronic
942507030 2:176654026-176654048 TTGGCAGAGCCAAGGGAGGACGG - Intergenic
942562002 2:177229719-177229741 GTGGCTGAAGAAAGGGATGGGGG - Intronic
942697760 2:178665029-178665051 TTGGTGGAACAAAGGGAGGATGG - Intronic
942727731 2:179027872-179027894 TTGGGTGAACAATGGGATGAGGG - Intronic
943009962 2:182435346-182435368 ATGGCTGAACAGGGGTTGGAAGG + Intronic
943180954 2:184540384-184540406 AGGGATGGAAAAAGGGAGGAAGG + Intergenic
943337647 2:186637824-186637846 ATGGATGGACAATGAGAGGATGG - Intronic
943560563 2:189456628-189456650 ATGACTGTAAAGAGGGAGGAGGG + Intronic
943574485 2:189615112-189615134 ATGCCTGAATAATGGGAGCATGG + Intergenic
943615406 2:190086578-190086600 ATAACTGAGCAAAGGGAGCATGG - Intronic
944446690 2:199798952-199798974 ATGCCTGAAGAATGGGAGGGGGG + Intronic
945223496 2:207508115-207508137 ATTGCTGTAAAAAGGGAGCATGG - Intergenic
946753738 2:222920946-222920968 AGGCCTGAATAAAGTGAGGAAGG - Intronic
947491748 2:230601843-230601865 GTGGCTGAATCCAGGGAGGAGGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947744298 2:232499765-232499787 AAGGCTGAAGAGAGGGAGGCTGG - Intergenic
948940210 2:241191528-241191550 GTGGCTGAACAGCTGGAGGATGG - Intronic
1169701471 20:8451803-8451825 ATGGAAGAAAGAAGGGAGGAAGG - Intronic
1169709728 20:8548081-8548103 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1170261774 20:14416654-14416676 ATGAAGGAAGAAAGGGAGGAAGG - Intronic
1170387423 20:15834511-15834533 ATGGCAGCACAAAGGGAGAGGGG - Intronic
1170621160 20:17997455-17997477 ATGGCTGAACAAAGGGAGGAAGG - Intronic
1171816585 20:29790815-29790837 AGGGATGAAGAAAGGAAGGAAGG - Intergenic
1171943967 20:31359286-31359308 AAGGCAGAACAAAGGGAAGAAGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173420952 20:42900627-42900649 ATGGATGAAGAAACTGAGGAGGG - Intronic
1173624460 20:44462084-44462106 AAGGCTGAAGACAGGCAGGAGGG + Exonic
1173628496 20:44491724-44491746 ATGGCTGAAGGAGGGAAGGAGGG + Exonic
1173653306 20:44681515-44681537 ATGTGTGAACAAATGCAGGATGG + Intergenic
1173737402 20:45372122-45372144 ATGGTTAAACAAAGAGAGGGTGG + Intronic
1174125630 20:48303057-48303079 ATGGATGAAGAAAGGATGGATGG - Intergenic
1174283960 20:49459165-49459187 ATGGCTGGACACGGGGAGGCAGG + Intronic
1174872826 20:54199450-54199472 CTGGCTGAACAATAGGAGAAAGG + Intergenic
1175398558 20:58685359-58685381 ATGACTGAGAAAAGGGGGGAAGG + Intronic
1175687983 20:61045213-61045235 ATGGATGAATAGACGGAGGATGG - Intergenic
1175984169 20:62755752-62755774 ATGGCTGGAGGGAGGGAGGATGG - Intronic
1176551059 21:8221972-8221994 ATGAATGAAGGAAGGGAGGAAGG - Intergenic
1176569968 21:8404971-8404993 ATGAATGAAGGAAGGGAGGAAGG - Intergenic
1176577879 21:8449178-8449200 ATGAATGAAGGAAGGGAGGAAGG - Intergenic
1178420739 21:32441342-32441364 GAGGCTGAATGAAGGGAGGAAGG + Intronic
1178661444 21:34510691-34510713 ACAGCTGAACACAGGCAGGAGGG + Intergenic
1179414200 21:41185297-41185319 GGGGCTAAACAAATGGAGGAAGG + Intronic
1179816214 21:43908004-43908026 ATAGCAGAGCAAAGGGATGATGG + Intronic
1179874838 21:44262358-44262380 AAGGGTGAAGAAAGGGATGAGGG + Intergenic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1180783506 22:18534702-18534724 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1181127073 22:20708753-20708775 CGGCCTGAACAAAGGGAGGATGG - Intronic
1181240408 22:21474054-21474076 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1181266956 22:21636041-21636063 ATGGCTGAGGAAAGGGTCGAGGG - Intronic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181490667 22:23258993-23259015 CAGGCGGAACAAAGGGAGCACGG + Intronic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1181737494 22:24893200-24893222 ATGAATGAATAAAGGAAGGAGGG + Intronic
1182033551 22:27179798-27179820 TTGGCTGAAGGAAGGAAGGAAGG + Intergenic
1182544383 22:31065989-31066011 AGGCCTGAACACAGGCAGGAAGG - Intronic
1182573767 22:31259080-31259102 AAGGGTGTACAAAGGGAGGAAGG - Intronic
1182805106 22:33062953-33062975 ATAGCTGAAGAAATGGAGGGTGG + Intergenic
1183085417 22:35483829-35483851 AGGAAGGAACAAAGGGAGGAAGG + Intergenic
1184023253 22:41834789-41834811 ATGGGTTAACAAATGGGGGATGG + Intronic
1184189908 22:42887634-42887656 ATGGCTGACCAAAGGAGGGGAGG + Intronic
1184238996 22:43201913-43201935 ACGGCTCCACAAAGGGAGGGAGG + Exonic
1185122064 22:48977252-48977274 ATTGCTGCACCAAGAGAGGATGG - Intergenic
1185206468 22:49541772-49541794 TGGGCTGGACACAGGGAGGATGG - Intronic
1203256066 22_KI270733v1_random:138902-138924 ATGAATGAAGGAAGGGAGGAAGG - Intergenic
1203281678 22_KI270734v1_random:134976-134998 AGGGCAGCACAAAGGGTGGAGGG + Intergenic
949649730 3:6143042-6143064 ATGGTCCAACAAAGGGAGGGAGG + Intergenic
950398797 3:12754346-12754368 ATGGCTGTACAGAAAGAGGATGG + Intronic
951379447 3:21965838-21965860 ATGGAAGAAAGAAGGGAGGAAGG + Intronic
951441132 3:22725480-22725502 ATGGATGAATAAATGGTGGATGG - Intergenic
952020475 3:29012939-29012961 AGGGAAGAAGAAAGGGAGGAAGG + Intergenic
952743067 3:36752627-36752649 AGACCTGAACAAAGGCAGGAAGG - Intergenic
953227586 3:41034589-41034611 ATGGAGGAAGAAAGGAAGGAAGG + Intergenic
954975314 3:54688449-54688471 ATGAATGAACAAATGAAGGAGGG + Intronic
956715275 3:72074190-72074212 ATGGCGTTACAAGGGGAGGAAGG - Intergenic
956735491 3:72234470-72234492 TTCCCTGGACAAAGGGAGGAAGG - Intergenic
956816221 3:72910847-72910869 GTGGCGGAACAAAGGGAAGCTGG + Intronic
956988848 3:74738804-74738826 TTGGCTGAAAAGGGGGAGGAGGG - Intergenic
957859033 3:85919384-85919406 ATGGCTGAAGGAAAGGAGGAAGG + Intronic
958983157 3:100748480-100748502 AGCCCTGACCAAAGGGAGGACGG - Exonic
959771616 3:110105746-110105768 ATGACTGAGCACAGGGAAGATGG - Intergenic
960913271 3:122670824-122670846 ATGCCTGAGCAATGTGAGGAGGG + Intergenic
961530136 3:127535659-127535681 ATGTTTGACCAAAGGGAGGAAGG - Intergenic
961861651 3:129921198-129921220 ATGGCAGAACAAGGAGAAGACGG + Intergenic
962349209 3:134644489-134644511 AAGGCTGGGCAAGGGGAGGATGG + Intronic
963180914 3:142355077-142355099 ATGGGGGAAGATAGGGAGGAGGG + Intronic
964040211 3:152252284-152252306 AGGGAGGAACAAAGGGAGGGAGG - Intronic
964451736 3:156819204-156819226 ATTCCTGAACAAAAGGAAGAAGG + Intergenic
966857755 3:184207037-184207059 AAGACTGAACAAAGTGAGAAGGG + Intronic
967158084 3:186711681-186711703 GTAGCTGAACACTGGGAGGATGG - Intergenic
967358030 3:188595468-188595490 ATGGCAGAGCAAGGGGAGGGTGG - Intronic
967791173 3:193550886-193550908 ATGGCTGAACGAAGGTATCATGG - Intronic
969031317 4:4217138-4217160 ATGGATGAACACAGGAAGAAAGG - Intronic
969571697 4:8012577-8012599 ATGGGTGAAGAATGGGTGGATGG - Intronic
969703216 4:8779056-8779078 AGGGCTGAACACAGGGGGCAGGG - Intergenic
970751966 4:19374628-19374650 ATGTCGTAACAAAAGGAGGAGGG - Intergenic
970808577 4:20064460-20064482 AGGATTGAATAAAGGGAGGATGG + Intergenic
971613220 4:28753523-28753545 ATCAGTGAACAAATGGAGGATGG - Intergenic
971745879 4:30579807-30579829 AAGTCTAAACAAAGGGAGAAAGG + Intergenic
973269293 4:48244958-48244980 ATTAATGAACAAAGGGAGGGAGG - Intronic
973680499 4:53313303-53313325 ATGGGGGAAAAAAGGGAGTAGGG + Intronic
973710852 4:53629256-53629278 GTGGCTGGAGACAGGGAGGAGGG - Intronic
973953753 4:56042479-56042501 ATGGAAGAAGAAAGGAAGGAAGG - Intergenic
974479228 4:62422360-62422382 ATGCCTGAGCAAAGAGAAGATGG - Intergenic
975217993 4:71779403-71779425 ATGCCTGAAGAAGGTGAGGAAGG + Intronic
975349199 4:73327373-73327395 ATGGATGCACATATGGAGGATGG - Intergenic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976705362 4:88014033-88014055 AGGGCTGACCAAGAGGAGGAGGG + Intronic
976821754 4:89214669-89214691 AAGCCTAAAGAAAGGGAGGAAGG - Intergenic
976892854 4:90071596-90071618 GTGGATGGAGAAAGGGAGGATGG - Intergenic
976987591 4:91321761-91321783 ATGACTGAAGACTGGGAGGATGG - Intronic
977143579 4:93407389-93407411 AAAGCTGATCAAAGGAAGGAAGG + Intronic
977899423 4:102402275-102402297 ATGGATGAAGAAAGGAAGGAAGG + Intronic
977960415 4:103078650-103078672 ATAAATGAACAAAGGTAGGAAGG - Intronic
978346734 4:107777913-107777935 ATGGAAGAAGGAAGGGAGGAAGG + Intergenic
978593157 4:110348332-110348354 ATTGCTGAACAAGTGCAGGATGG - Intergenic
979101083 4:116615410-116615432 ATGAGGGAACAAAGGAAGGAAGG + Intergenic
979729262 4:124003941-124003963 ATTTTTGAACAGAGGGAGGAAGG + Intergenic
979733391 4:124052472-124052494 ATGGGTGAGCCAAAGGAGGAAGG + Intergenic
981775575 4:148363359-148363381 ATGACTGAAAAATGGAAGGAAGG - Intronic
982304296 4:153913754-153913776 ATGGCTGGAGAAAGGGAGGGAGG - Intergenic
982785637 4:159533619-159533641 ATAGCTGAACAAAAGGAAGCAGG - Intergenic
983575426 4:169256280-169256302 AGGGAGGAAGAAAGGGAGGAAGG + Intronic
983732697 4:171015675-171015697 ATGGACGAAGAAAGGGAGAAAGG + Intergenic
984947722 4:184983064-184983086 ATGGAGGAAGACAGGGAGGAGGG - Intergenic
986465639 5:8019999-8020021 AGTGCTGAGCAAAAGGAGGAAGG - Intergenic
987785817 5:22497420-22497442 ACGGGTGAGCAAAGGAAGGAAGG - Intronic
988682357 5:33496305-33496327 ATAGCTGAACACAGGGAGGGTGG - Intergenic
989441178 5:41474065-41474087 GAGACTGAACAAAGGGATGAAGG + Intronic
989517556 5:42361083-42361105 ATGCCTGAACAAGGGGAGGCAGG - Intergenic
990157305 5:52892824-52892846 AGGGTTGAACGAGGGGAGGAAGG + Intronic
991922556 5:71671317-71671339 ATGGATAAAGAAAGAGAGGAAGG - Intergenic
992084958 5:73270081-73270103 ATGGCAGAACAGACGGAGGGAGG - Intergenic
992489127 5:77223969-77223991 ATGGATGAACAAAGGGAAGATGG - Intronic
993319085 5:86450627-86450649 ATGGCTCAAAAAAGAGAAGATGG - Intergenic
993432295 5:87846768-87846790 GTGGCTGAACAAAGACAGCAGGG - Intergenic
993439670 5:87940188-87940210 ATGGCTGGAGTAAGGTAGGAAGG - Intergenic
994071067 5:95603017-95603039 ATAGCTGGACAATGGTAGGAAGG + Intronic
994073142 5:95622991-95623013 AAGGAGGAACAAAGAGAGGAAGG - Intergenic
995409252 5:111836065-111836087 ATGAATGAACGAAGGGAGGAAGG - Intronic
995701115 5:114937071-114937093 AAGGCTGAGAAAAGGGAAGAAGG + Intergenic
996034759 5:118746236-118746258 ATCCCTGAACAAAGGGAGTCTGG - Intergenic
998160009 5:139808111-139808133 AAGGCCCAACAAGGGGAGGAAGG + Intronic
998297491 5:140985650-140985672 ATGGCTGAATAAAGGAAGTGGGG + Intronic
998444416 5:142187603-142187625 AGGGAGGAAGAAAGGGAGGAAGG - Intergenic
998545790 5:143026468-143026490 AAATCTGAACAAAGGGAGGGAGG + Intronic
998675069 5:144398060-144398082 ATAGCTGAACAATGAGAGCATGG + Intronic
999008399 5:148007036-148007058 CTTGCTAAACAAAGGGAGAAAGG - Intergenic
999405020 5:151299173-151299195 TTGGTTGAACAAATGGATGAAGG - Intronic
999684107 5:154087066-154087088 ATGGGTGACTAAAGTGAGGATGG + Intronic
1000094744 5:157961436-157961458 ATGACTGAGCAAACGGCGGACGG + Intergenic
1000444601 5:161304362-161304384 ATGGCATAACAGAGGGATGAAGG + Intronic
1002472236 5:179442400-179442422 GTGGGTGAACAAATGGATGAAGG + Intergenic
1002472264 5:179442578-179442600 GTGGGTGAACAAATGGATGAAGG + Intergenic
1002644887 5:180648257-180648279 CTGGCTCAACCAGGGGAGGAGGG - Intronic
1003140293 6:3465747-3465769 ATGAACGAACAAAGGAAGGATGG + Intergenic
1003863312 6:10341533-10341555 ATTGCTAAGGAAAGGGAGGAAGG + Intergenic
1004566427 6:16802257-16802279 CTGGATGAAGAAAGGGACGATGG + Intergenic
1004751297 6:18565444-18565466 ATGGAGGAAGAAAAGGAGGAAGG - Intergenic
1004751465 6:18566148-18566170 AGGGAGGAAGAAAGGGAGGAAGG - Intergenic
1004826597 6:19428168-19428190 ATGGATGTACACATGGAGGAAGG - Intergenic
1005341221 6:24845475-24845497 ATGGCAGCACAGAGGGAGGTGGG + Intronic
1005808987 6:29502135-29502157 TTGCATGACCAAAGGGAGGAGGG + Intergenic
1005822016 6:29606341-29606363 AGGGATGCACAAAGGCAGGAGGG - Intronic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1006336349 6:33422818-33422840 AGGGTTGAACTAGGGGAGGAGGG + Intronic
1006620280 6:35359163-35359185 GTGGCTGGACAGAGGGAGGGAGG + Intronic
1007321607 6:41032217-41032239 AGGACAGAACAAAGGCAGGAGGG + Intronic
1007898451 6:45386703-45386725 ATGGTTTAACAAAATGAGGAAGG + Intronic
1007972685 6:46068432-46068454 ATGGTTGAATGAAGGAAGGAGGG - Intronic
1009500940 6:64413110-64413132 ATGGCTGCACAAGGTGAGGAAGG - Intronic
1012420336 6:99057708-99057730 ATTGCTAAAGAAAGGGAGGAAGG - Intergenic
1013105746 6:107025484-107025506 ATGGCTGAACCCAGAGAGGGAGG + Intergenic
1016925761 6:149346104-149346126 ATAGATGAAGAGAGGGAGGAAGG + Intronic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017355183 6:153496737-153496759 AGGCCTGAAAAAAGGGAGGAAGG - Intergenic
1017610150 6:156176900-156176922 ATGGCAGAGCAAGGGAAGGAAGG + Intergenic
1017734980 6:157354609-157354631 GAGGCTGAACAGTGGGAGGATGG - Intergenic
1018037446 6:159893425-159893447 AGGGCCCAACAAAGTGAGGAGGG + Intergenic
1018049070 6:159991974-159991996 ATGCCTGAAGGAAGGGAGGCAGG + Intronic
1018662859 6:166104652-166104674 AGGGCTGAAGAGAGAGAGGATGG - Intergenic
1019334897 7:478438-478460 AAGGGAGGACAAAGGGAGGAAGG + Intergenic
1020484408 7:8703835-8703857 ATAATTGAACAAAGGGAGGGTGG - Intronic
1021001610 7:15338650-15338672 ATCACTGTGCAAAGGGAGGAAGG + Intronic
1021698630 7:23297064-23297086 ATTTATGAACAAAGGGATGAGGG + Intergenic
1021784445 7:24138014-24138036 ATTGCTGAATTAAGGAAGGAAGG - Intergenic
1021906278 7:25336988-25337010 ATGGGAGAAGAAAGGGAAGAGGG + Intergenic
1022786133 7:33639232-33639254 ATGGCTGGGGAGAGGGAGGAGGG + Intergenic
1023564371 7:41508810-41508832 ATGGCTGCATAAAGGAAGCAGGG + Intergenic
1023915642 7:44586820-44586842 CTGGTTGAACAAATGAAGGACGG - Intergenic
1024343050 7:48286507-48286529 CTGTCTGAAAAAAGGAAGGAAGG - Intronic
1026210084 7:68296328-68296350 AAGGCTGAACAAACGGAAGTGGG + Intergenic
1026964561 7:74431009-74431031 ATGGATGGATGAAGGGAGGAGGG - Intergenic
1027453844 7:78362728-78362750 ATAGTTGAACAAAAGGAGCATGG - Intronic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1029714578 7:102318938-102318960 ATGGGGGAACAAAGGGTGGGTGG + Intronic
1031793312 7:126137911-126137933 ATGCCTGAACAAATGAATGAAGG - Intergenic
1031922623 7:127612918-127612940 ATGGATGGACGAATGGAGGATGG + Intronic
1032231649 7:130079857-130079879 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1032231659 7:130079885-130079907 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1032231678 7:130079945-130079967 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1032539922 7:132694421-132694443 ATGGGTGGAGAAAGGGAGGCTGG - Intronic
1033644314 7:143288755-143288777 TGGGTTGAACAAAGGGAGGCTGG - Intronic
1033681730 7:143601672-143601694 ATGGCTGATGAAAGACAGGAAGG - Intergenic
1033703161 7:143860141-143860163 ATGGCTGATGAAAGACAGGAAGG + Intronic
1034140676 7:148812661-148812683 CTTTCTGAACAAAGTGAGGAAGG + Intronic
1037099016 8:15019621-15019643 TTTGCTGGACAAAGGGAGGTGGG + Intronic
1037339807 8:17832250-17832272 ATGGCGGGAGGAAGGGAGGAGGG + Intergenic
1037564480 8:20105935-20105957 AAGGCTGCACAGAGGGAGAAGGG + Intergenic
1037627693 8:20622397-20622419 ATGGCTTAACAAAGGGTTGGTGG - Intergenic
1039314561 8:36356828-36356850 ATGAATGAAGGAAGGGAGGAAGG + Intergenic
1040435043 8:47381913-47381935 CTGGTAGAACAAAGGGAGGATGG - Intronic
1041042185 8:53858636-53858658 ATTGCTGAAGAAAGAGAGGCAGG + Intronic
1041381597 8:57258848-57258870 CTGGCTGCACAAAGGGTTGAGGG - Intergenic
1042869008 8:73380580-73380602 ATGGCCGAACAAAGGCCTGAAGG - Intergenic
1043124282 8:76369483-76369505 ATGGCTGAAATAAGGTAGAAAGG - Intergenic
1043464569 8:80492024-80492046 ATGGCAGAAATAAGGGCGGAAGG + Intronic
1044268964 8:90217321-90217343 ATTGCTGAAGAAAGTGAGAATGG - Intergenic
1044744866 8:95362225-95362247 AGGGGTGAACAAAGGCATGAAGG + Intergenic
1045035490 8:98173445-98173467 ATGGCTGACTGGAGGGAGGAAGG + Intergenic
1045073693 8:98539277-98539299 TTGGGGGAAAAAAGGGAGGAAGG + Intronic
1045317132 8:101052864-101052886 ATGGCAGGGCAGAGGGAGGATGG - Intergenic
1045490821 8:102667667-102667689 ACAGCTGAAGATAGGGAGGAAGG + Intergenic
1045689617 8:104746812-104746834 CTGGCTTAACAGAGGGAGGTAGG + Intronic
1046644435 8:116769370-116769392 ATGGGTGAAGAAGGGCAGGAAGG + Intronic
1047306774 8:123659037-123659059 ATGGCTGAATGAATGGATGATGG - Intergenic
1047307934 8:123668309-123668331 TTGGCTGGAGAAAGGGAGGAAGG + Intergenic
1047360485 8:124164515-124164537 TTGAATTAACAAAGGGAGGAGGG - Intergenic
1048232177 8:132653218-132653240 ATGGAAGAAGGAAGGGAGGAAGG + Intronic
1048299738 8:133242650-133242672 CTGGCTGAAAGAAGGGATGATGG + Intronic
1048348270 8:133594982-133595004 ATGGCTAAAGAGAGAGAGGAAGG - Intergenic
1048657154 8:136553141-136553163 ATGGATGAAGAAAGTGAGGAAGG - Intergenic
1049350714 8:142163098-142163120 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350789 8:142163494-142163516 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350903 8:142164107-142164129 ATGGATGAACAGAGGATGGATGG + Intergenic
1050074094 9:1845916-1845938 ATGGCTGTTCACAGGCAGGAAGG + Intergenic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1050602039 9:7262592-7262614 ATGGCAGAAAAAAGGGAAGTAGG + Intergenic
1050690415 9:8221295-8221317 CTGGCTGGACAAAGGGATGTGGG + Intergenic
1050730560 9:8704341-8704363 ATGACGGAAGAAAGGAAGGAAGG + Intronic
1051824376 9:21203036-21203058 ATGGCAGCACAAAGGTAGGCAGG + Intergenic
1053599316 9:39594053-39594075 AGGGTGGAAGAAAGGGAGGAAGG - Intergenic
1053857021 9:42348239-42348261 AGGGTGGAAGAAAGGGAGGAAGG - Intergenic
1054254208 9:62748333-62748355 AGGGTGGAAGAAAGGGAGGAAGG + Intergenic
1055042795 9:71893532-71893554 ATGGCTGAGCACATGGAGGGTGG - Intronic
1057604515 9:96489456-96489478 ATGGATGAGCAAAGGGAACAAGG - Intronic
1058387881 9:104460189-104460211 CTGAGTGAACAAGGGGAGGATGG + Intergenic
1059651609 9:116320688-116320710 ATGGCAGAAAAAAGAGAGGGGGG - Intronic
1059669665 9:116480103-116480125 ATGGGTGAAGAAAGGAAGGAAGG + Intronic
1060379396 9:123152723-123152745 ATGGCTGAGCAGAGAGAGGCGGG + Intronic
1061417514 9:130455113-130455135 ATGGATGAATAAATGGATGATGG - Intronic
1061783083 9:133007220-133007242 ATGGATGGACAATGGGTGGATGG + Intergenic
1061868663 9:133508359-133508381 ATGGATGAAGAAAGTAAGGAAGG - Intergenic
1062016308 9:134292964-134292986 ATGAATGAACGAAGGAAGGAAGG + Intergenic
1062049123 9:134438129-134438151 GTGCCTGAACAGAGGGTGGATGG + Intronic
1062276723 9:135734870-135734892 ATGACTGCACAAAGGGCCGATGG - Intronic
1203472226 Un_GL000220v1:120615-120637 ATGAATGAAGGAAGGGAGGAAGG - Intergenic
1185695770 X:2193308-2193330 ATGGGTGAAGGAAGGAAGGAGGG - Intergenic
1185758892 X:2674109-2674131 ATGTGTGAGCAAAGGCAGGAAGG - Intergenic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1186077694 X:5898371-5898393 ATGGCGGAGAAAAGGAAGGAAGG - Intronic
1186107134 X:6219604-6219626 ATGGAGGAACGAAGGGAGGAAGG - Intronic
1186210541 X:7245852-7245874 AAGGCTGAAGAATGAGAGGAGGG - Intronic
1187716776 X:22110601-22110623 ATGGCTGCATAGAGGGAGGGGGG - Intronic
1187747795 X:22428694-22428716 AAGGATGAAAAAAGGCAGGAAGG - Intergenic
1187836514 X:23437134-23437156 AAGGCTGAACAAAGGTAGCAGGG - Intergenic
1188551738 X:31372255-31372277 TTGGCTGACCAGATGGAGGAAGG + Intronic
1189161114 X:38809900-38809922 AATGCAGAACAGAGGGAGGAAGG - Intergenic
1189301303 X:39954510-39954532 ATGAATGAACAAATGAAGGAAGG + Intergenic
1190087526 X:47408811-47408833 ATGACAGCACCAAGGGAGGATGG + Intronic
1192877362 X:75245791-75245813 GTGGGTGGAGAAAGGGAGGAGGG + Intergenic
1193534905 X:82702139-82702161 TTGCATGAACAAAGGGAGGGTGG - Intergenic
1193640128 X:84002484-84002506 AAGGCTGAATGAAGGGAGTAAGG - Intergenic
1195001580 X:100647987-100648009 ATGAATGAACAAAGGCATGAAGG - Intronic
1197815995 X:130499381-130499403 AAGGCAGAAGGAAGGGAGGAGGG - Intergenic
1197820773 X:130538839-130538861 AAGCCTAAACAAAGTGAGGAGGG + Intergenic
1198518748 X:137431762-137431784 AAGGAAGAACAAAGGAAGGAAGG + Intergenic
1200864079 Y:8023924-8023946 AGGGCTTAAGAAAGAGAGGAGGG + Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201586719 Y:15569208-15569230 CAGGCTGAACAAATGGGGGAAGG + Intergenic
1201624946 Y:16004548-16004570 AGAGCTGAACACAGGGAGGCTGG + Intergenic