ID: 1170622630

View in Genome Browser
Species Human (GRCh38)
Location 20:18008275-18008297
Sequence AACCCACCAGTTATGGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170622630_1170622636 17 Left 1170622630 20:18008275-18008297 CCTTGATCCATAACTGGTGGGTT 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1170622636 20:18008315-18008337 TCCGCCCCATCCCCACTGCTGGG 0: 1
1: 0
2: 2
3: 33
4: 252
1170622630_1170622635 16 Left 1170622630 20:18008275-18008297 CCTTGATCCATAACTGGTGGGTT 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1170622635 20:18008314-18008336 CTCCGCCCCATCCCCACTGCTGG 0: 1
1: 0
2: 4
3: 58
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170622630 Original CRISPR AACCCACCAGTTATGGATCA AGG (reversed) Intronic
902363902 1:15958549-15958571 AGCCCACCAGTTATGGAGATTGG - Intronic
908298039 1:62732836-62732858 AACCCACCAAATTTGGATAAAGG + Intergenic
909883868 1:80915368-80915390 CAGACTCCAGTTATGGATCATGG - Intergenic
910671851 1:89781781-89781803 GACCCACCAGCTACAGATCAGGG + Intronic
912857020 1:113178290-113178312 AACCCCCCAGTCATGAGTCATGG + Intergenic
923967277 1:239155958-239155980 GACCCACCAGCTATAAATCAGGG + Intergenic
1066423950 10:35288067-35288089 ATCCCACCAGTAATGTATAAAGG + Intronic
1068161683 10:53272481-53272503 TACCCACCAGTTGTGGGTCAAGG - Intergenic
1073998533 10:109343403-109343425 AAGCCACCAGGTGTGGACCATGG + Intergenic
1074207649 10:111297881-111297903 CACACAGCAGTCATGGATCATGG - Intergenic
1076465412 10:130677911-130677933 AACCCAACAGTTAGGGACCTTGG - Intergenic
1077288257 11:1777239-1777261 AACACTCCAGTTCTGGAGCAGGG - Intergenic
1080548523 11:33347314-33347336 AACCCACCAGTTATTCAATAAGG + Exonic
1084117443 11:67050387-67050409 AGCTCACCAGTTATGGACCAAGG - Exonic
1084625675 11:70304574-70304596 GACCAACCAGCTATGAATCAGGG - Intronic
1084660476 11:70543729-70543751 GACCGACCAGCTATGAATCAGGG - Intronic
1091853209 12:3717732-3717754 ATGCCAGCAGTTATGGATCCTGG + Intronic
1097213100 12:57387472-57387494 AACCCACCAATTCTGGACAAAGG + Intronic
1098986899 12:77022240-77022262 AACCCATCAGTTTTAGTTCAGGG + Exonic
1104352298 12:128055581-128055603 AACCCATCAGTTCTGCAGCAGGG + Intergenic
1105617837 13:22036506-22036528 AACCCACCATGTATTAATCAGGG + Intergenic
1107791759 13:44009347-44009369 AACCCAGGATTTATGAATCAAGG - Intergenic
1107792310 13:44014879-44014901 AACCTACTAGTTATGGAGCTAGG + Intergenic
1110142556 13:72148770-72148792 TGCCCACCAGTTATAGATTAAGG - Intergenic
1114234024 14:20808899-20808921 AATCCACTAGTTGAGGATCATGG - Intergenic
1116448468 14:45038849-45038871 AAACCTCCAGTTGTGGAGCAAGG + Intronic
1116797192 14:49404226-49404248 CACCCACCAGAAATAGATCATGG - Intergenic
1117449194 14:55834678-55834700 GACCTACCAGTTATATATCAGGG + Intergenic
1118355087 14:65006909-65006931 GACCTACCAGCTATGAATCAGGG - Intronic
1121053010 14:90831564-90831586 AGCCCACCAGGAAGGGATCAGGG - Intergenic
1123921677 15:25074481-25074503 AACCCAAGAGGTATGAATCAAGG - Intergenic
1132334901 15:101041710-101041732 AATCCACCAGCTGTGGATAAGGG - Intronic
1141030803 16:80586668-80586690 AACCCAAGAGTTATGTATCATGG - Intergenic
1142636512 17:1260810-1260832 AACCCACTACTTATTAATCAAGG - Intergenic
1147564749 17:41529183-41529205 AAGGCACCAGTTCCGGATCAGGG + Intergenic
1148138649 17:45312239-45312261 GGCCAACCAGTTATGGAGCAAGG + Intronic
1148238736 17:45986209-45986231 AACCCACCAGGCCTGGCTCAGGG + Intronic
1151567044 17:74904475-74904497 AACCCACCAGTTATTGTTTGGGG + Intergenic
1156121800 18:33852686-33852708 AACACATCACTTACGGATCAAGG + Exonic
1157698960 18:49747370-49747392 AACCAATCAGTTATAAATCAGGG - Intergenic
1163647773 19:18499806-18499828 AACCCACCAGGGATGGCTGATGG + Intronic
1164858278 19:31542311-31542333 AACCGAACAGGTATGGAACACGG + Intergenic
1168683034 19:58329914-58329936 TTCCCACCAGTTGTGGATGAGGG - Intronic
932818824 2:74882293-74882315 AACCAGCCAGGTATGGAGCAGGG + Intronic
934034875 2:88080813-88080835 AAACCATCAGTTAGGGATAAAGG + Intronic
937638688 2:124187277-124187299 CAGCCACCAGTTATGCATGATGG - Intronic
937731797 2:125241454-125241476 AACCAACCAGGTATGGGTAATGG + Intergenic
945369437 2:208998907-208998929 AACTCAACAATTATGGATCTTGG + Intergenic
945740602 2:213655955-213655977 AACCCACCAGAAATAGTTCATGG - Intronic
1170054193 20:12181270-12181292 TTCCCACCAGTAATGGATGAGGG + Intergenic
1170622630 20:18008275-18008297 AACCCACCAGTTATGGATCAAGG - Intronic
1173356988 20:42302724-42302746 AACCCACCAATTATTTATTATGG - Intronic
1179487369 21:41719098-41719120 AACCCACAAGTCAGGAATCAAGG + Intergenic
1180795324 22:18601171-18601193 ATCCCAGCAGTTTTGGAGCAAGG + Intergenic
1181226416 22:21394141-21394163 ATCCCAGCAGTTTTGGAGCAAGG - Intergenic
1181252234 22:21540697-21540719 ATCCCAGCAGTTTTGGAGCAAGG + Intergenic
950354571 3:12395731-12395753 AACCCATCATTTCTGGACCATGG + Intronic
950895283 3:16444010-16444032 AACCCACTAGATATGGAACCTGG + Intronic
962045972 3:131759260-131759282 AAGCCACCATTCATGTATCAGGG + Intronic
964893230 3:161561752-161561774 ACCCAACCAGTTGTGAATCATGG - Intergenic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
971384799 4:26132904-26132926 AACCCACCTATGATGGAGCAGGG - Intergenic
972718968 4:41676701-41676723 AACCCTCCAAGTATGGATAAGGG + Intronic
973537559 4:51898599-51898621 AATCCACCAATAATGGAACAGGG + Intronic
974816141 4:67005868-67005890 AATCAACCAGTTATGGGACAGGG + Intergenic
985107912 4:186516592-186516614 AACCCAGCAGTCATGGGACATGG - Intronic
987240400 5:15992617-15992639 AACCAACGAGTTAGGGAACAAGG - Intergenic
988407405 5:30841357-30841379 AGCCCAGCAGCTATGGATGAGGG - Intergenic
991159612 5:63482560-63482582 ATCCCACCAGCTATGCATAAGGG - Intergenic
993065186 5:83089629-83089651 GACCAACCAGTTATAAATCAAGG + Intronic
994049495 5:95346205-95346227 AAACCACCAGTTAGGGAGGAAGG - Intergenic
997422459 5:133780084-133780106 CACCCATCAGTCATGGGTCAAGG + Intergenic
997970984 5:138401735-138401757 ATCCCACCAGTAATGTATGAGGG + Intronic
1002323756 5:178391612-178391634 TTCCCACCAGCTATGGATGAGGG - Intronic
1005078830 6:21936269-21936291 AGCCCTCTAGTTATGGCTCATGG - Intergenic
1009947580 6:70357500-70357522 AACTCACCACTTATGACTCAAGG - Intergenic
1011055653 6:83200832-83200854 AACCCTCTTTTTATGGATCAGGG + Intergenic
1011846966 6:91577292-91577314 AACACATCAGTGATGGCTCAGGG + Intergenic
1013045294 6:106479538-106479560 ATCCCACCAGTAATGTATAAGGG + Intergenic
1013073659 6:106751790-106751812 AATCCACCAGTCATGGCTGAGGG - Intergenic
1014600557 6:123406883-123406905 AACCCACCAGGCTTGGAGCAAGG - Intronic
1021006026 7:15396175-15396197 AACCCACCATTTCTGGACGAGGG - Intronic
1024103389 7:46056775-46056797 GACCCACCAGCTATAGATCAGGG - Intergenic
1032476688 7:132215989-132216011 GACCCACCAGTTATAAGTCAGGG - Intronic
1032943786 7:136826786-136826808 AACCACCAAGTTATGAATCATGG - Intergenic
1040408818 8:47134512-47134534 TCCCCACCAGCTATGGGTCATGG + Intergenic
1042222828 8:66490294-66490316 GACCCACCAAGTATGGACCATGG + Intronic
1045553524 8:103193626-103193648 AACCAACCAGTGATGGATCCAGG - Intronic
1057542523 9:95988906-95988928 AACCAACCAGCTATAAATCAGGG + Intronic
1059469454 9:114493619-114493641 AAGTCACCAGTTATCTATCAGGG + Intronic
1188887020 X:35563028-35563050 AACGCACCAGTTAGGTATGAGGG + Intergenic
1189093602 X:38113868-38113890 AATCCACCAGTCATTGATCAAGG - Intronic
1190521521 X:51283089-51283111 TACCCCACAGTTATGCATCATGG - Intergenic
1194521216 X:94920571-94920593 AACCTACGAGTTATGGATGGTGG - Intergenic
1196841352 X:119862122-119862144 GACCCACCAGCTATAAATCAGGG - Intergenic
1198562381 X:137865091-137865113 AACCCACCAGGTAGCAATCATGG + Intergenic
1198654363 X:138897535-138897557 AACCTACCAGTGAAGCATCAGGG + Intronic
1202370596 Y:24193075-24193097 AACCCAACAGGGATGAATCACGG - Intergenic
1202500188 Y:25477042-25477064 AACCCAACAGGGATGAATCACGG + Intergenic