ID: 1170623323

View in Genome Browser
Species Human (GRCh38)
Location 20:18011835-18011857
Sequence GGCTGCGGCGAGCAAGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 2, 2: 5, 3: 32, 4: 297}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170623323_1170623326 -7 Left 1170623323 20:18011835-18011857 CCGGCTCCTTGCTCGCCGCAGCC 0: 1
1: 2
2: 5
3: 32
4: 297
Right 1170623326 20:18011851-18011873 CGCAGCCGCCTTTACCGCTGCGG 0: 1
1: 0
2: 0
3: 7
4: 69
1170623323_1170623328 0 Left 1170623323 20:18011835-18011857 CCGGCTCCTTGCTCGCCGCAGCC 0: 1
1: 2
2: 5
3: 32
4: 297
Right 1170623328 20:18011858-18011880 GCCTTTACCGCTGCGGACTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170623323 Original CRISPR GGCTGCGGCGAGCAAGGAGC CGG (reversed) Intronic
900014678 1:139678-139700 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900044545 1:494880-494902 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900044944 1:498287-498309 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900065949 1:729786-729808 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900066348 1:733195-733217 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900066744 1:736601-736623 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900067142 1:740017-740039 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900420616 1:2554476-2554498 GGATACGGGGAGCAGGGAGCGGG + Intergenic
900604655 1:3518566-3518588 GGCTGCGCCGAGGCAGGGGCTGG + Intronic
900784088 1:4636770-4636792 GGCAGCGCTGAGGAAGGAGCGGG + Intergenic
900798561 1:4724130-4724152 GGCTGGGGTGGACAAGGAGCAGG + Intronic
902156629 1:14492907-14492929 GGCTGCAGCGAGCAAGTGGTGGG - Intergenic
902404665 1:16176026-16176048 GGCTGCGGAGAGCAAAGCCCAGG + Intergenic
903224131 1:21885304-21885326 GGCTGCAGTGAGCAGGGAGCTGG - Exonic
903224563 1:21887373-21887395 GGGTGCGGGGAGCAGGAAGCTGG - Intronic
904379396 1:30101075-30101097 GGCTGCCCCGAGGAAGGAGGGGG - Intergenic
904398555 1:30240481-30240503 GGCTGCAGGGAGAAAGGAGACGG - Intergenic
905172445 1:36117081-36117103 GGCAGAGGCAAGCAAGCAGCTGG - Intronic
905205214 1:36339466-36339488 GGCTGCGGGGAGCAGGGAGGGGG + Intergenic
905297352 1:36962571-36962593 GCCTGAGGCGAGCAAGCAGACGG + Intronic
905383760 1:37584384-37584406 GGCTGCAGTGAGCCATGAGCAGG + Intronic
907312677 1:53548044-53548066 GGATGCGGCCAGCAGGGAGGCGG - Intronic
908949395 1:69541306-69541328 GACTGTGGAGAGAAAGGAGCAGG - Intergenic
911208622 1:95117558-95117580 GGCTGCGCCGAGCCGGGAGAGGG - Exonic
912270139 1:108200274-108200296 GGCTGCGGCGCGCAGGGCGCAGG + Exonic
915322614 1:155064006-155064028 GGCGGCGCCGCGCAAAGAGCGGG - Intronic
917884397 1:179369138-179369160 GGCTGCAGTGAGCAATGATCAGG - Intronic
918799380 1:188953263-188953285 GGCTGCAGCAGGCATGGAGCTGG + Intergenic
920415397 1:205796035-205796057 GGCTGAGAAGAGCAGGGAGCAGG - Intronic
922101074 1:222477135-222477157 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
922262173 1:223952273-223952295 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
922584818 1:226725667-226725689 GGCTGGAGTGAGCAAGGAGGGGG - Intronic
922733545 1:227967537-227967559 GGCTGCTGGGAGGTAGGAGCTGG - Intergenic
922757043 1:228102471-228102493 GGCTGGGGAGCGCAAGGTGCGGG - Exonic
924819821 1:247478559-247478581 GGTTGCGGTGAGCCAGGATCAGG - Intergenic
1066733251 10:38451643-38451665 GGCTGCCGAGAGCCATGAGCTGG - Intergenic
1067368657 10:45661343-45661365 GGCTGCAGCAAGGGAGGAGCAGG - Intronic
1067529337 10:47059143-47059165 GGCTGAGGAGAGCAGGGAACAGG + Intergenic
1069473876 10:68716307-68716329 AGCTTCGGCTAGCAAGGCGCTGG + Intergenic
1069693602 10:70371197-70371219 GGCTGCGGTGAGCCATGATCGGG - Intronic
1069830027 10:71277334-71277356 GCCTGAGGCCAGCAAGGGGCTGG + Intronic
1070036891 10:72734674-72734696 GGCTGCGGTGAGCCATGATCAGG - Intronic
1071568207 10:86682330-86682352 GGCAGTGGCGTGCAGGGAGCGGG + Intronic
1072107884 10:92291284-92291306 GGCGGCGGAGAGCGAGGAGGAGG - Exonic
1074998221 10:118775776-118775798 GGCTGCGGGGAGGGAGGAGTAGG - Intergenic
1075438497 10:122461779-122461801 GGCTGCGGCGGGCAGCGCGCCGG - Exonic
1075824475 10:125343058-125343080 GGCTGAGGGGAGCAGCGAGCAGG - Intergenic
1076970875 11:131355-131377 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1076971273 11:134778-134800 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1077062665 11:624765-624787 GGCGGCGGGGAGCCAGGGGCTGG - Intronic
1077108162 11:850767-850789 GGCTGCACCGAGGAGGGAGCGGG - Intronic
1077437509 11:2549898-2549920 GGGGGCGGTGGGCAAGGAGCCGG - Intronic
1078446635 11:11409606-11409628 GACTGGGGAGAGCATGGAGCTGG - Intronic
1080902636 11:36510273-36510295 GGCTGCGGGGAGCGAGGGGCAGG + Intergenic
1081725566 11:45325564-45325586 GGCTGGGGGGAGCGAGGAGTGGG - Intergenic
1083163143 11:60867800-60867822 GGCTGCTGCCAGAAGGGAGCTGG + Intronic
1083617975 11:64035821-64035843 GGCGGCGGCGAGCAGGGCGCGGG - Intronic
1083680516 11:64349593-64349615 GGCGGCGACCAGCAAGGAGGAGG + Exonic
1084105796 11:66979463-66979485 GGCTGCAGTCAGCTAGGAGCTGG - Intergenic
1084452933 11:69250803-69250825 GGCTGCTGCGGACGAGGAGCTGG + Intergenic
1084527244 11:69704817-69704839 GGCCGGGGCGAGCGCGGAGCAGG - Intergenic
1085296686 11:75435363-75435385 GGCTGCGGCTGACAAGGGGCTGG + Exonic
1088893126 11:114059876-114059898 GGCTGCGGTGAGTGAGGGGCCGG + Exonic
1089254179 11:117185481-117185503 AGCTGTGGTGAGCAAGGAACAGG + Intronic
1089455795 11:118625111-118625133 GGCTGAAGTGAGCAAGGAGGAGG - Intronic
1090437453 11:126698503-126698525 GGCTGCAGGGAGAAAGGGGCTGG + Intronic
1090832412 11:130428475-130428497 GGCGGCGGCGCGGGAGGAGCGGG - Exonic
1090954507 11:131502490-131502512 GGCTGAGGGGAGGCAGGAGCTGG + Intronic
1091616169 12:2052830-2052852 TGCGGCGGCGCGCAGGGAGCCGG - Intronic
1091797586 12:3306071-3306093 GGTTGGTGCGAGCAAGGAACTGG + Intergenic
1093026881 12:14253531-14253553 GGCTGCAGGGAGCCAGGATCAGG + Intergenic
1093459427 12:19394913-19394935 GGCTGCGGTGAGCAAGCATTGGG + Intergenic
1094026926 12:25969067-25969089 GGCTGGGGGGAGCAAAGGGCTGG + Intronic
1095776281 12:46013517-46013539 GGTTGCAGTGAGCCAGGAGCGGG - Intergenic
1096513216 12:52143346-52143368 GGCTGGGGAGACCAAGGGGCTGG - Intergenic
1099989690 12:89709052-89709074 GGCTGCGGCGCTCACGGAGGTGG - Intronic
1101254180 12:102961344-102961366 GCAGGCGGCGAGCGAGGAGCCGG - Intergenic
1101641238 12:106586895-106586917 GGCTTGGGAGAGCAAGGAGCCGG + Intronic
1102047185 12:109836734-109836756 GGCTGCAGTGAGCTATGAGCAGG - Intergenic
1103563360 12:121803919-121803941 GGAAGCGGCGAGGAAGGAGAGGG + Intergenic
1103930245 12:124446291-124446313 GGCTGCAGGGAGGAAGGACCTGG - Intronic
1103958550 12:124593288-124593310 TGCCGGGGAGAGCAAGGAGCTGG - Intergenic
1104946487 12:132417024-132417046 GGCTGCCGCCAGCAAGGGGGTGG - Intergenic
1104961550 12:132490509-132490531 GCCTGCTGCGAGCCAGGCGCGGG + Exonic
1105037103 12:132933523-132933545 GGCTGCAGCGAGGAAGGAGCTGG - Intronic
1106419500 13:29573882-29573904 GTCTGCGGCTAGAAAGGTGCTGG - Intronic
1107339791 13:39394001-39394023 GGCTGCAGTGAGCTAGGATCAGG - Intronic
1115592210 14:34874959-34874981 GGCGGCGGCGGGCGAGGAGCCGG - Intronic
1117278995 14:54219496-54219518 GGCTGCGGAGAGCAAGGGTCAGG - Intergenic
1120815000 14:88846960-88846982 GGGTGGGACGAGCAAGGAGGAGG - Intronic
1120898892 14:89558752-89558774 GCCAGAGGTGAGCAAGGAGCAGG + Intronic
1121120714 14:91374118-91374140 GGCTGCGGGGAGGAAGGCTCTGG + Intronic
1121190643 14:92026466-92026488 GGCTGCGGCGAGCAAGGAGGCGG - Intronic
1122273715 14:100580432-100580454 GGCAGCGGGGAGCACGGGGCGGG - Intronic
1122741154 14:103872198-103872220 GGCTGCGGCAGGCAAGGCCCGGG - Intergenic
1125664145 15:41417068-41417090 GCGTGCGGCGAGCAGGGGGCGGG + Intronic
1128078237 15:64841633-64841655 GGCTGCGGCGGGGGAGGAGAGGG - Intergenic
1128103760 15:65028350-65028372 GGCTGCAGTGAGCTATGAGCCGG + Intronic
1128987310 15:72230868-72230890 GGCTGGGGCGGGAAAGGAGCCGG + Intronic
1129273970 15:74433520-74433542 CGCTGCGGCGAGCGAGCGGCGGG - Intronic
1129516459 15:76160488-76160510 GGGTGCAGCCAGTAAGGAGCGGG + Intronic
1129706493 15:77797602-77797624 GGCTGCTGGGAGCCAGGTGCTGG - Intronic
1130224415 15:82046316-82046338 GGCTGCGGCGAGCGCGGGGGTGG - Intergenic
1130654751 15:85784670-85784692 GGCTGCAGCCAGCAAGGAAATGG + Intronic
1130699869 15:86167306-86167328 GGTTGCAGCGAGCCAGGATCAGG - Intronic
1131098947 15:89673234-89673256 GGCTGCCTGGAGCATGGAGCCGG - Exonic
1134091898 16:11396001-11396023 GGCTGCTGGGAGTAAGGAGGGGG + Intronic
1134388186 16:13793918-13793940 GGCTGCAGCCAGAAGGGAGCAGG - Intergenic
1136136279 16:28258695-28258717 AGCTGGGGAGAGCAGGGAGCCGG + Intergenic
1136479365 16:30532319-30532341 GGCAGCGGGGAGCAAGGTGCTGG + Exonic
1136483070 16:30555013-30555035 GGCAGTGGGGAGCAAGGTGCTGG + Exonic
1136779261 16:32886461-32886483 GGCTGCAGCCTGCCAGGAGCGGG - Intergenic
1136891356 16:33975057-33975079 GGCTGCAGCCTGCCAGGAGCGGG + Intergenic
1137237315 16:46626350-46626372 GGCTGGGGAGAGCAAGGAGGTGG + Intergenic
1139296442 16:65905609-65905631 GGCTGCGGGGAGCAACAGGCAGG - Intergenic
1139358804 16:66383761-66383783 GGCTGTGGCGTGCAGGGGGCAGG - Intronic
1139548578 16:67661159-67661181 GGTGGCGGGGACCAAGGAGCTGG - Intronic
1142147033 16:88497018-88497040 GGGTGGAGCGAGCCAGGAGCAGG - Intronic
1142299221 16:89247108-89247130 GGCTGGGGCCTGCCAGGAGCGGG - Intergenic
1142448981 16:90162744-90162766 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1142449382 16:90166163-90166185 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1203081677 16_KI270728v1_random:1148549-1148571 GGCTGCAGCCTGCCAGGAGCGGG - Intergenic
1142457714 17:65718-65740 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1142458115 17:69138-69160 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1142458509 17:72545-72567 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1143714053 17:8754510-8754532 GGCTGCGGTGAGCTATGATCTGG + Intronic
1143750128 17:9021727-9021749 GGCCGCGCCGGGCATGGAGCTGG + Intronic
1145285935 17:21506065-21506087 GGCTAGGGGGAGCAAGGAGATGG - Intergenic
1146053435 17:29569139-29569161 GGGTGCGGCGAGAACAGAGCGGG - Intronic
1147423112 17:40332244-40332266 GGCTGGGGGGAGGAGGGAGCCGG + Intronic
1147758183 17:42781752-42781774 GGATGCGGGAAGCCAGGAGCTGG + Intronic
1147778391 17:42920613-42920635 GGCTGCAGCGAGCCATGATCGGG - Intergenic
1148842449 17:50508017-50508039 GGCTGCAGCGAGCGTGGACCCGG + Intergenic
1149995815 17:61405464-61405486 GGCGGCCGAGGGCAAGGAGCAGG + Exonic
1151066025 17:71151092-71151114 GGCTGGGGCAAAAAAGGAGCAGG - Intergenic
1151877051 17:76872830-76872852 GCCTGCGGAGAGGAAGGAGGCGG - Exonic
1151974486 17:77476566-77476588 GCCTGCGGGGAGGAGGGAGCTGG + Intronic
1152157323 17:78643491-78643513 TGCTGCGGGGAGCTAGGGGCTGG - Intergenic
1152644120 17:81460990-81461012 GGCAGCGGCCAGCAAGGGGCCGG + Exonic
1152793354 17:82293494-82293516 GGCTGCGGGGAGGGAGGGGCGGG + Intergenic
1152919136 17:83057079-83057101 GGCAGGGGCCAGGAAGGAGCGGG + Intergenic
1153716892 18:7859379-7859401 GGCTGCCACCAGCAAGGATCAGG - Intronic
1153872619 18:9334720-9334742 AGGGGCGGGGAGCAAGGAGCCGG + Intergenic
1154138660 18:11803230-11803252 GGCTGTGGGGAGGAAGGAGTTGG - Intronic
1154492643 18:14933438-14933460 GCCTGCAGAGAGCAAGGGGCAGG + Intergenic
1159382886 18:67685646-67685668 GGCTGCAGTGAGCAATGATCAGG + Intergenic
1160647827 19:201644-201666 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1160648226 19:205058-205080 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1160710142 19:547639-547661 GGCTGCGGTGTGGAAGGAGCTGG - Intronic
1160810596 19:1011351-1011373 GGCTGCGGTGAGCGTGGCGCGGG - Exonic
1160824781 19:1074522-1074544 GGCTGCAGGGACCAGGGAGCTGG + Intronic
1161023900 19:2025983-2026005 GGCTGCAGTGAGCTAAGAGCAGG + Intronic
1161382130 19:3971010-3971032 GGCTGCGGAGGGTAAAGAGCGGG - Exonic
1161688959 19:5719849-5719871 GGCGGCGCGGAGGAAGGAGCCGG - Exonic
1161967127 19:7555042-7555064 GGCTGCGGCGCGAAAAGAGGCGG - Exonic
1162607279 19:11719366-11719388 GGCTGAGGAGAGCAAGGAAAAGG + Intergenic
1162651113 19:12089734-12089756 GGCTGCAGAGAGCTAGGATCAGG - Intergenic
1162950644 19:14070357-14070379 GGACGCGGCGACCAAGGAGGAGG - Intergenic
1163606998 19:18281082-18281104 GGTGGCGGCCAGCGAGGAGCAGG - Exonic
1163818665 19:19483530-19483552 GGCTGCGGCTGGCGAGAAGCAGG + Intronic
1165326492 19:35117201-35117223 GGCTGCAGGGAGCCGGGAGCTGG - Intronic
1165746004 19:38229708-38229730 GGCTGCGGCGCGAGCGGAGCGGG + Intronic
1165758927 19:38309416-38309438 GGCCGCGCAGGGCAAGGAGCTGG - Exonic
1166097364 19:40549263-40549285 GGAGCCGGCGAGCAAGGAGCTGG + Exonic
1166451875 19:42908875-42908897 GGCTGCTGGAAGCCAGGAGCTGG + Intronic
1166628618 19:44384932-44384954 GGCTTCAGCGAGCAATGATCAGG + Exonic
1167082239 19:47284785-47284807 GGCTGCAGTGAGCCATGAGCAGG - Intergenic
1167240310 19:48339443-48339465 GGGTGCGGGGAGCAAGGTGCGGG - Intronic
1167621947 19:50565707-50565729 TGCTGGGGCCAGCAGGGAGCCGG - Intronic
1168104826 19:54160295-54160317 GGCTGCGGGGGTCAAAGAGCCGG + Exonic
1168401492 19:56088226-56088248 GGCGGCGGGGGGCGAGGAGCCGG - Exonic
925096247 2:1206389-1206411 GACTGCAGAGAGCAAAGAGCTGG + Intronic
925419953 2:3703721-3703743 GGCCCCGGCGAGCGAGGAGCGGG + Exonic
926094222 2:10070705-10070727 GGCTGCAGCGAGCTATGATCAGG - Intronic
926121123 2:10241596-10241618 GGATGCGGCGAGGCAGGGGCTGG - Intergenic
927502418 2:23591540-23591562 GGCTGTGGGGGGTAAGGAGCAGG - Intronic
927964777 2:27262250-27262272 GGGGGCGGCGAGGAAGGAGCAGG - Intronic
930751763 2:54941430-54941452 GGCTACGCTGAGGAAGGAGCTGG - Intronic
932705189 2:74019192-74019214 GGCTGCGGTGAGCTATGATCTGG + Intronic
932718485 2:74120588-74120610 GGCTGAGGAGCCCAAGGAGCGGG + Intergenic
933787705 2:85857180-85857202 GGCTGCAGTGAGCAATGATCGGG + Intronic
934522317 2:95026977-95026999 GGCTGCGGCGGCCTGGGAGCAGG + Intronic
934751561 2:96797293-96797315 GGCCGGGGTGAGCAGGGAGCAGG + Intronic
935997186 2:108786967-108786989 GGCTGCGCGGGGCACGGAGCGGG - Intronic
938092007 2:128440477-128440499 GGCCCCAGTGAGCAAGGAGCGGG + Intergenic
942070314 2:172310179-172310201 GGCTGCAGTGAGCCAGGATCAGG - Intergenic
944716068 2:202376780-202376802 GGCTGAGGAGAGGTAGGAGCGGG - Intergenic
947641154 2:231708570-231708592 GGCTGCGGCGAGCAAGGAGGCGG - Exonic
948415325 2:237798796-237798818 GGCTGCGGAGAGCGGGGCGCTGG + Exonic
948631167 2:239303503-239303525 GGCTGTCCCGAGAAAGGAGCGGG - Intronic
948772311 2:240257992-240258014 GGCGGCGGAGAGCCAGGAGCGGG + Intergenic
1170623323 20:18011835-18011857 GGCTGCGGCGAGCAAGGAGCCGG - Intronic
1171767411 20:29297739-29297761 GGCAGGGGCGGACAAGGAGCGGG + Intergenic
1173338618 20:42134464-42134486 GGCTGTGGCGAGGAGGGAACTGG + Intronic
1174411863 20:50341535-50341557 GGCTGAGCTGGGCAAGGAGCTGG + Intergenic
1174501225 20:50986188-50986210 GGCTGCGGTGAGCTATGATCTGG - Intergenic
1176057268 20:63155357-63155379 GGAGGAGGCGAGCAGGGAGCAGG + Intergenic
1176077360 20:63254511-63254533 GGCTGCGGCGCGTGGGGAGCGGG - Exonic
1176129627 20:63491184-63491206 GCCTGCAGGGAGCAGGGAGCAGG - Intronic
1176129634 20:63491207-63491229 GCCTGCAGGGAGCAGGGAGCAGG - Intronic
1176217241 20:63954024-63954046 GGCTGGGGGGAGGAGGGAGCAGG + Intronic
1176286490 21:5021723-5021745 GGGTGCGGTGGGGAAGGAGCAGG + Intergenic
1176952457 21:15064287-15064309 GTATCCAGCGAGCAAGGAGCAGG + Intronic
1178507129 21:33171372-33171394 GTCTGCGGCCAGCGAGGAGAGGG + Intergenic
1179870691 21:44241752-44241774 GGGTGCGGTGGGGAAGGAGCAGG - Intergenic
1179873286 21:44254522-44254544 GGATGAGGCGGGCAAGGAGGCGG - Intronic
1179926766 21:44539144-44539166 GGCTCCTGGGAGCAAGGAGGGGG + Exonic
1180870578 22:19144532-19144554 GGCTGCGACGAGCAAGCAGCGGG - Exonic
1181023127 22:20113730-20113752 GGATGCGGGGAGCATGGTGCTGG - Exonic
1181316615 22:21974723-21974745 GGCTGCCGGGAGCCAGGAGCAGG + Intronic
1182247878 22:28974706-28974728 GGCTGCAGTGAGCTAGGATCTGG - Intronic
1183079558 22:35447808-35447830 GGTTGGGGCAGGCAAGGAGCGGG + Intergenic
1184653036 22:45927831-45927853 GGTTGCGGTGAGCAGAGAGCAGG + Intronic
1184726078 22:46347412-46347434 GGCTGCAGCGAGCCAAGATCGGG - Intronic
1185063624 22:48620073-48620095 GGCGGCGTCGAGGAAGGACCCGG + Intronic
1185363618 22:50424081-50424103 GGCTGAGGAGAGGAAGGGGCAGG + Intronic
949414271 3:3799422-3799444 GGCTGCGGGGAGCACAAAGCGGG + Exonic
950424236 3:12916010-12916032 GGCTGTGGTTAGCATGGAGCAGG - Intronic
953427021 3:42804072-42804094 GACGGCGGGGAGCGAGGAGCGGG - Intronic
954716773 3:52530878-52530900 GGCTGCAGGGAGAAGGGAGCAGG + Intronic
956736708 3:72244082-72244104 TGCTGGGGAGAGCAAGGAGGTGG - Intergenic
956982167 3:74651736-74651758 GGCTGCAGTGAGCAATGATCAGG - Intergenic
957054185 3:75431673-75431695 GGCTGCGGTGAGCCAAGATCGGG - Intergenic
958865987 3:99502217-99502239 GGCTGTGGCCAGAAAAGAGCAGG + Intergenic
958959160 3:100492544-100492566 AGCTGCGGCCACCAATGAGCTGG + Intergenic
961243990 3:125435692-125435714 GGCTGCGGCCAACAAGCAGTTGG - Intergenic
961305703 3:125958296-125958318 GGCTGCCGCGAGCTAGGCGCTGG + Intergenic
961750434 3:129091042-129091064 GGCTGGGGAGAGCAAGGAGGTGG + Exonic
962240257 3:133746105-133746127 GGCTACGGCGGGCTGGGAGCCGG - Exonic
967836836 3:193971902-193971924 GGCTGTGCTGAGCAACGAGCAGG - Intergenic
968258190 3:197297998-197298020 GGCCGCGGCGAGCGAGGAGGCGG - Intronic
968353432 3:198081081-198081103 GGCTGCTGCGAGCAGGCAGAGGG + Intergenic
968369620 3:198215057-198215079 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
968370020 3:198218471-198218493 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
969427028 4:7130409-7130431 GGCTGCTGCGTGCGGGGAGCTGG - Intergenic
969921855 4:10547651-10547673 GGCTGCCAGGAGCAAGGAGGAGG - Intronic
972703302 4:41515212-41515234 GGCTGCGGTGATCACGCAGCCGG + Intronic
977354422 4:95927083-95927105 GGCTGTGGGGAGCAAGGGGAGGG - Intergenic
979329630 4:119410120-119410142 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
980130015 4:128809785-128809807 GGCCGCGGCGGGCGGGGAGCCGG - Exonic
981044542 4:140253106-140253128 GGCTTCGGCGACCCAGGAGCAGG - Intergenic
982171743 4:152668564-152668586 TGCTGAGCCGAGCAAGGAGTGGG - Intronic
985517623 5:354975-354997 GGCTGCGGCCAGCCGGGACCCGG - Intronic
985659216 5:1147521-1147543 GGCTGTGGAGACCAAGGTGCTGG - Intergenic
986061856 5:4199221-4199243 GGCTTCTGACAGCAAGGAGCGGG - Intergenic
986063756 5:4216021-4216043 GGCTGTGGGGTGCATGGAGCAGG + Intergenic
986693740 5:10333965-10333987 GGCAGCGGCGACCCAGGGGCTGG + Intergenic
988585192 5:32501764-32501786 GGCTGCGAAAAGCAGGGAGCAGG + Intergenic
988733105 5:33993076-33993098 GGCTGTGGGGAGGTAGGAGCGGG - Intronic
992896350 5:81248471-81248493 GCCTGCTGCAAGCAAGGACCAGG + Intronic
996055052 5:118973605-118973627 GGCTGCCGCGAGCAAGGAGGCGG - Intronic
997539323 5:134648714-134648736 GGCTGCTGCGAGCCCGGAGCCGG + Intronic
997560974 5:134846048-134846070 GGCGGCGGCGAGGCAGGCGCTGG - Exonic
999768170 5:154756040-154756062 GGCGGCGGCGAGCCAGGCGCTGG + Intronic
1000358258 5:160421930-160421952 GGCTCCGGCGGGGAAGGAGGCGG + Exonic
1002521744 5:179796192-179796214 GGTTGCGGCGGGGAAGAAGCGGG + Intronic
1002728900 5:181320642-181320664 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1002729299 5:181324049-181324071 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1003163075 6:3652623-3652645 GGCTGAGGAGAGGAAGGAGCGGG - Intergenic
1004913315 6:20307660-20307682 GGCTGAGGGGAGCAAGGAATGGG + Intergenic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1007602453 6:43091031-43091053 GGAAGCGGGGAGCAAGGAGGGGG - Intronic
1012475729 6:99613581-99613603 AGCAGCAGCAAGCAAGGAGCCGG + Exonic
1013619422 6:111873333-111873355 GGCTGCCGCGGGCGAGGAGGAGG - Exonic
1017542074 6:155413321-155413343 GGGTGGGGAGAGCAAGGAGATGG + Intronic
1018434958 6:163751423-163751445 GGCTGCGGGGAGGGAGGAGGAGG - Intergenic
1019112037 6:169724329-169724351 GGCTGAGGCGAGCGAGTGGCGGG - Intronic
1019112042 6:169724351-169724373 GGCTGAGGCGAGCGAGCGGCGGG - Intronic
1019293636 7:262401-262423 TGGTGCTGCCAGCAAGGAGCTGG + Intergenic
1019442527 7:1054679-1054701 GGGTGCGGCGGGCAAGAGGCTGG + Intronic
1019731511 7:2631946-2631968 GGCGGCGGCGAACAAAGAGGCGG + Exonic
1020039913 7:4994164-4994186 GGCTGCAGTGAGCAATGATCAGG - Intronic
1023400693 7:39791740-39791762 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1024075300 7:45814852-45814874 GGCTGCTGAGAGCCATGAGCTGG - Intergenic
1024569085 7:50709488-50709510 GCCTGAGGCCAGCAAGGAGAGGG - Intronic
1024649712 7:51392714-51392736 GGCTGCTGGGAGGTAGGAGCTGG + Intergenic
1025131895 7:56378518-56378540 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1025182958 7:56832972-56832994 GGCTGCTGGGAGGCAGGAGCTGG + Intergenic
1025688969 7:63744002-63744024 GGCTGCTGGGAGGCAGGAGCTGG - Intergenic
1026045636 7:66903949-66903971 GGCCGCGGCGAGGCACGAGCCGG - Intergenic
1026045673 7:66904076-66904098 CGCAGCCACGAGCAAGGAGCTGG - Intergenic
1026735355 7:72945524-72945546 GGCAGAGGCAAGCGAGGAGCCGG - Intronic
1026785695 7:73300454-73300476 GGCGGAGGCAAGCGAGGAGCCGG - Intergenic
1027202235 7:76071601-76071623 GGCTGTTGCGAGGCAGGAGCTGG + Intergenic
1027202531 7:76072749-76072771 GGCTGTTGCGAGGCAGGAGCTGG + Intergenic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1032051021 7:128651185-128651207 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1032240007 7:130153257-130153279 GGCTCCGGCGGGGAAGGGGCTGG + Intergenic
1032322994 7:130901341-130901363 GCCTGCGGGGAGCAGGGAGCAGG - Intergenic
1034431780 7:151044773-151044795 TGGTGCTGGGAGCAAGGAGCAGG + Intronic
1034879468 7:154752373-154752395 GGCTGTGACTGGCAAGGAGCGGG + Intronic
1034996032 7:155577797-155577819 GGCTGCAGTGAGGATGGAGCGGG + Intergenic
1035029401 7:155847757-155847779 GGCTGCGGGGAGGAAGGTGTGGG - Intergenic
1035081344 7:156219136-156219158 GTCTGCAGGGAGCACGGAGCAGG + Intergenic
1035081366 7:156219239-156219261 GTCTGCAGGGAGCACGGAGCAGG + Intergenic
1035081373 7:156219273-156219295 GTCTGCAGGGAGCACGGAGCAGG + Intergenic
1035081380 7:156219308-156219330 GTCTGCAGGGAGCATGGAGCAGG + Intergenic
1035081386 7:156219340-156219362 GTCTGCAGGGAGCACGGAGCAGG + Intergenic
1037260361 8:17001531-17001553 GGCTGCGGCGACAAACCAGCAGG + Intronic
1038038977 8:23707996-23708018 GGCTGCAGCGAGCCATGATCCGG - Intergenic
1039068782 8:33632008-33632030 GGCGGCGTGGAGCAAGGAGCGGG - Intergenic
1039542296 8:38382214-38382236 GGCGGCGGCCAGCACGGAGGCGG - Exonic
1039901331 8:41754858-41754880 GGCTGCGCCTGGAAAGGAGCTGG - Intronic
1041246117 8:55889829-55889851 GGCTGCTGCTGGCAAGGTGCTGG + Intronic
1043428424 8:80171418-80171440 GACCGCGGCGAGCAAGGTGAGGG - Intronic
1044374019 8:91448245-91448267 GCCTGCGGGGAGCAAGGATTAGG - Intergenic
1045587873 8:103559489-103559511 GGCTGCTGTGAGAAGGGAGCAGG + Intronic
1049349006 8:142154129-142154151 GGCCCCGGAAAGCAAGGAGCTGG - Intergenic
1049443109 8:142618126-142618148 GGCTGCGTGGAGTGAGGAGCCGG + Intergenic
1049620730 8:143597359-143597381 GGACGCGGCGACCAAGGAGGAGG + Exonic
1053142673 9:35690939-35690961 GGCTGCGGCGGGGAAGGCGGAGG + Exonic
1054569014 9:66789875-66789897 GGCTGCAGCGAGCCAAGATCAGG - Intergenic
1054849039 9:69827631-69827653 GGATGAGGCGAGCAAGGACAAGG - Intronic
1055945527 9:81688711-81688733 GGCGGCGGCGGGCGAGGTGCAGG + Exonic
1056637975 9:88347181-88347203 GGCTGCGGTGAGCCAGGATCTGG + Intergenic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1060302211 9:122381393-122381415 GGAAGCGGCGGGCCAGGAGCTGG - Exonic
1061159513 9:128885087-128885109 GGTTTCGGGGAGCCAGGAGCTGG - Intronic
1062753960 9:138277741-138277763 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1203576479 Un_KI270745v1:12520-12542 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1203576876 Un_KI270745v1:15929-15951 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1203577278 Un_KI270745v1:19350-19372 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1185778768 X:2828723-2828745 GGCCGCGGCGGGCGAGGGGCGGG + Intergenic
1186496500 X:10015710-10015732 GGCGGCGGCGCGGAAGGAGCTGG - Exonic
1188302606 X:28524228-28524250 AGCTGAGGGGAGTAAGGAGCAGG + Intergenic
1189586501 X:42467574-42467596 GGGTGGGGCCAGCAAGGAACAGG + Intergenic
1190772440 X:53526646-53526668 GGCTGCACAGAGCAAGGGGCGGG - Intergenic
1191830206 X:65407585-65407607 GGCGGCGGCGGGCGAGGCGCAGG - Intronic
1195346458 X:103954821-103954843 AGCTGTGGGGAGCAGGGAGCAGG - Intronic
1195360990 X:104084015-104084037 AGCTGTGGGGAGCAGGGAGCAGG + Intergenic
1200086529 X:153609947-153609969 GGCTTCGGAGAGGAAGGAGAAGG - Intergenic
1200093127 X:153644935-153644957 GGCTGTGACCAGCAGGGAGCTGG - Intronic
1200093817 X:153648019-153648041 GGCTGCGGCAGTCCAGGAGCAGG - Exonic
1200100495 X:153687539-153687561 GGCTGCAGCCTGCCAGGAGCGGG + Intronic