ID: 1170624592

View in Genome Browser
Species Human (GRCh38)
Location 20:18021574-18021596
Sequence GAATCCTCAGAGCACCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 288}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170624592_1170624599 29 Left 1170624592 20:18021574-18021596 CCCCAGGGGTGCTCTGAGGATTC 0: 1
1: 0
2: 4
3: 35
4: 288
Right 1170624599 20:18021626-18021648 ACCTAGCTCACTGCCCAAAAAGG 0: 1
1: 0
2: 0
3: 6
4: 123
1170624592_1170624596 3 Left 1170624592 20:18021574-18021596 CCCCAGGGGTGCTCTGAGGATTC 0: 1
1: 0
2: 4
3: 35
4: 288
Right 1170624596 20:18021600-18021622 CAGAAAACATCTGCCCAGCTAGG 0: 1
1: 0
2: 1
3: 27
4: 258
1170624592_1170624601 30 Left 1170624592 20:18021574-18021596 CCCCAGGGGTGCTCTGAGGATTC 0: 1
1: 0
2: 4
3: 35
4: 288
Right 1170624601 20:18021627-18021649 CCTAGCTCACTGCCCAAAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170624592 Original CRISPR GAATCCTCAGAGCACCCCTG GGG (reversed) Intronic
900637187 1:3671693-3671715 CAATCCTCAGAGGAACCCAGCGG - Intronic
902105829 1:14035360-14035382 GAGTCCCCAGATAACCCCTGGGG + Intergenic
902377321 1:16035959-16035981 GAATCCTCACAGCAGCCCTAGGG - Intergenic
902382498 1:16059212-16059234 GAATCCTCACAGCAGCCCTAGGG - Intronic
902790400 1:18763949-18763971 GACTCCTCACAGCAGCCCTTTGG - Intergenic
903299013 1:22364811-22364833 GAATAATCAGAGCAACCTTGAGG - Intergenic
904092035 1:27951943-27951965 TAATCCTCATAACAACCCTGTGG - Intronic
904299923 1:29547625-29547647 GGATCCTCAGAGCAACCCCAAGG - Intergenic
904326989 1:29732982-29733004 GATTCCTCAGAGGTCCCCAGTGG + Intergenic
904357739 1:29951943-29951965 GTGTCCTCAGGGCCCCCCTGTGG - Intergenic
904405353 1:30284860-30284882 GGATCCTCAGAGCAACCCCAAGG + Intergenic
904460851 1:30679009-30679031 GAATTGTCAGAACAACCCTGTGG - Intergenic
904673715 1:32184556-32184578 GAATACTCTGAGTACCCCAGAGG + Exonic
905245636 1:36611336-36611358 GAATGCTCACAGCTGCCCTGTGG - Intergenic
905639155 1:39576637-39576659 GAATCCTCGGAGAACCCGCGGGG - Intronic
906546644 1:46624143-46624165 GTGTCCTCTGGGCACCCCTGTGG - Intergenic
906811527 1:48832001-48832023 TGATCCTCAGAACAACCCTGAGG + Intronic
907653352 1:56317902-56317924 GCAGGCTCAGGGCACCCCTGTGG - Intergenic
907699986 1:56776882-56776904 CAATCCTCACAACATCCCTGGGG + Intronic
909093547 1:71257578-71257600 GAATCTTCAGAGCACAGGTGTGG + Intergenic
911144168 1:94536456-94536478 GAGTCCTCATAGCAACCCAGGGG + Intronic
911247506 1:95535134-95535156 CAAACTTCAGAGCTCCCCTGAGG + Intergenic
912259623 1:108097428-108097450 ATATCCTCAGAGCACTTCTGTGG + Intergenic
912576629 1:110677532-110677554 TAATCCTCATAACACCCCTGTGG + Intergenic
913239859 1:116820473-116820495 CAATCCTCACAACAACCCTGTGG - Intergenic
918320088 1:183355910-183355932 GAAATCTCAGAGCACCACTGAGG + Intronic
919501036 1:198338548-198338570 GATTCCTCACAGCAACCCTATGG + Intergenic
919689651 1:200517700-200517722 GATGCCTCAGAGCAGACCTGTGG + Intergenic
920179719 1:204124956-204124978 GCATACACACAGCACCCCTGGGG - Intronic
920435448 1:205943945-205943967 TAGTCCTCTGAACACCCCTGAGG + Intergenic
920650706 1:207835272-207835294 GAAACCTCAGAGGACCTGTGTGG - Intergenic
920915634 1:210255961-210255983 GAAACCTCACAGGACCCCTGGGG + Intergenic
920933228 1:210408104-210408126 TAATCCTCACAGCAATCCTGAGG - Intronic
921339379 1:214119380-214119402 TAATCCTCATAGCAACCCTATGG - Intergenic
921847529 1:219899738-219899760 TAATCCTCAAAACAACCCTGAGG - Intronic
922736568 1:227986142-227986164 GCATCCTCAGAAAACACCTGAGG + Intergenic
1062880579 10:974770-974792 TAATCTTCACAGCACCCTTGAGG - Intergenic
1067498071 10:46776303-46776325 GGGTCCTCGGAGCACCCCCGAGG - Intergenic
1067596575 10:47564111-47564133 GGGTCCTCGGAGCACCCCCGAGG + Intergenic
1067747236 10:48945045-48945067 GAATCCTCAAAGCTCCACTGGGG - Intronic
1069537244 10:69263692-69263714 TGATCCTCAGAGCAATCCTGGGG - Intronic
1069609340 10:69762277-69762299 TAATCCTCACAGCAACTCTGAGG + Intergenic
1070227949 10:74531177-74531199 CAATCCTCAGTGCACACATGAGG + Intronic
1071167377 10:82822484-82822506 GACTCCTCAGAGGATCTCTGGGG + Intronic
1071431346 10:85609419-85609441 GAATCCTCAGTGCAACGCTGTGG + Intronic
1072520456 10:96226002-96226024 CAATCATCACAGCAACCCTGGGG - Intronic
1072667771 10:97406880-97406902 GAATCCTCACAGCAGCCCAGTGG - Intronic
1074060387 10:109960185-109960207 GAATCCTCACAACAACCCTGAGG + Intergenic
1075468799 10:122672472-122672494 GAAGCCTCACAACACCCCAGAGG - Intergenic
1075534502 10:123258874-123258896 GAATTCCAAGAGCACCACTGGGG + Intergenic
1076244994 10:128939782-128939804 AAACCGTCAGAGCATCCCTGAGG - Intergenic
1076940570 10:133604230-133604252 GCATCATCAGAGGACACCTGAGG + Intergenic
1079450267 11:20595514-20595536 TAATCCTCAGGCCACCCTTGAGG + Intergenic
1080058564 11:27932711-27932733 GAATAGGCAGAGCAGCCCTGAGG + Intergenic
1080419869 11:32100281-32100303 ATATCGTCAGAGCACCTCTGGGG + Intronic
1080697009 11:34611469-34611491 TAATCCTCACAGCAGCCTTGGGG + Intergenic
1081372926 11:42326004-42326026 GAATGGTCACAGGACCCCTGGGG - Intergenic
1082004258 11:47410967-47410989 CAACCCTCAGAGCAGCCCTGCGG + Intronic
1082468952 11:53216440-53216462 GAATCCTCACAATACCCCTATGG + Intergenic
1085319897 11:75567630-75567652 GAATCCTTAAAGCAACCTTGGGG + Intronic
1085727362 11:78965726-78965748 GAATATTCAGAGCAACCCAGAGG - Intronic
1086061038 11:82700142-82700164 TAATCCTCATAACAACCCTGTGG + Intergenic
1086373379 11:86176678-86176700 TAATTCTCAGAACAACCCTGAGG + Intergenic
1087083496 11:94194514-94194536 GAATCCTCACAACAACCCTGAGG - Intergenic
1087151055 11:94860186-94860208 TAATCCCCATAGCAGCCCTGAGG + Intronic
1087390686 11:97528599-97528621 TAATCCTCACACCACCACTGTGG + Intergenic
1088517886 11:110658161-110658183 TAATCCTCACAACAACCCTGAGG - Intronic
1088683679 11:112267187-112267209 TTATCTTCAAAGCACCCCTGAGG + Intronic
1088720974 11:112591379-112591401 TAATCCTCAGAGCAACTGTGAGG + Intergenic
1089731611 11:120522844-120522866 CAACCCTCAGCGCAGCCCTGTGG - Intronic
1089783653 11:120892605-120892627 GAAGCCCCAGAGGACCCCTGTGG + Intronic
1089822004 11:121236999-121237021 GCATCATCAGAGGACACCTGAGG + Intergenic
1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG + Intergenic
1090954914 11:131505156-131505178 AAATCCTCAAACCACTCCTGTGG - Intronic
1091600589 12:1915558-1915580 GAAACCTCAGAGAACGCGTGAGG + Intronic
1091606109 12:1952847-1952869 GAAACTTCAGAGTACCCCAGGGG - Exonic
1093149438 12:15603893-15603915 TAATCCTCAGTGCAGCCCTGTGG - Intergenic
1094798893 12:34007047-34007069 GAATCCTCATAGCAACACTGAGG - Intergenic
1095111647 12:38301126-38301148 GAATCCTCATAGCAACACTGAGG - Intergenic
1095651203 12:44611656-44611678 TGATCCTTACAGCACCCCTGTGG + Intronic
1098088849 12:66879368-66879390 GAATCCACACAACAACCCTGTGG + Intergenic
1101052877 12:100882159-100882181 GAATCTTCAAACCAACCCTGTGG + Intronic
1101091495 12:101291220-101291242 TCATCCTCACAGCAACCCTGAGG - Intronic
1101593498 12:106142388-106142410 TAATCCTCATACCAACCCTGTGG - Intergenic
1102199483 12:111047544-111047566 GAATCCTCCCAGCATCCCTTGGG + Intronic
1102589795 12:113948665-113948687 GAATCCTCACAGCAGCTCAGGGG + Intronic
1102944517 12:116974209-116974231 GAATCCTCAGCCAATCCCTGGGG - Intronic
1103294390 12:119874002-119874024 TAATCCTCACAACAACCCTGTGG + Intronic
1103747761 12:123137529-123137551 GAATCCACACAGCAGCCTTGAGG + Intronic
1103925909 12:124423254-124423276 GACTCCACCCAGCACCCCTGGGG - Intronic
1104032274 12:125073487-125073509 AAATCCTCACAACAGCCCTGTGG + Intronic
1107213616 13:37888789-37888811 GAAGCCACAGAGCAGCCCAGTGG + Intergenic
1107541741 13:41395180-41395202 GAATCCTCAAACCACCCATTAGG + Intergenic
1107610639 13:42109266-42109288 GAGTCCTCACAACACCCCTATGG + Intronic
1108844101 13:54657533-54657555 TAATCCTCAGTACAACCCTGAGG + Intergenic
1109380448 13:61552225-61552247 CAATCATCAGAGCACCCCTGGGG - Intergenic
1109918845 13:69028517-69028539 CAACCCTCAGAACAGCCCTGTGG - Intergenic
1112324806 13:98436805-98436827 GAACCCTCAGAAAAGCCCTGTGG + Intronic
1112396201 13:99034569-99034591 CCATCCTCATGGCACCCCTGAGG - Intronic
1113586304 13:111468365-111468387 GGATCCCCACAGCACCCCAGGGG - Intergenic
1115408156 14:33042221-33042243 GCTTCCTCAGTGCACCTCTGGGG + Intronic
1116925562 14:50631927-50631949 GAATTTTCAGCACACCCCTGGGG + Intronic
1117316609 14:54577107-54577129 GGCTCCTCAGAGGATCCCTGTGG - Intronic
1117828379 14:59726858-59726880 GAATGCTCAGAGCACCCAGAGGG + Intronic
1119885856 14:78141410-78141432 TAATCCTCACAACAACCCTGTGG - Intergenic
1119962620 14:78877230-78877252 CGATCCTCATAGCACCCCAGTGG - Intronic
1120035639 14:79694270-79694292 TAAACCTCAGAACACCCTTGGGG - Intronic
1120724195 14:87919450-87919472 GAATCCCCAAAGCAGGCCTGTGG - Intronic
1120755602 14:88241371-88241393 TAATCCTCACAACAACCCTGTGG - Intronic
1121654083 14:95582222-95582244 TAACCCTCATAGCACCCCTGTGG - Intergenic
1202926979 14_KI270724v1_random:35525-35547 TAATCCTCATAGCACCCTGGGGG + Intergenic
1123888189 15:24748744-24748766 GAGTCCCCAGAGAAGCCCTGGGG + Intergenic
1124096281 15:26651316-26651338 GAATAAACAGGGCACCCCTGTGG + Intronic
1124223439 15:27869629-27869651 CAAACCTCAGAGCCCCCCAGAGG + Intronic
1124424226 15:29549707-29549729 GACTCCTCACAGAACCCCTCAGG + Intronic
1128247289 15:66141855-66141877 GATTCCTCAAAGCACAGCTGAGG - Intronic
1128331979 15:66761913-66761935 GAATCCACACACCACCCCAGTGG - Intronic
1128559765 15:68656834-68656856 GAATCCTCAGAACAGCCTCGGGG - Intronic
1128880092 15:71234909-71234931 GGATCCTCAGTGCAGCCCTGGGG - Intronic
1129120110 15:73391119-73391141 CAATCCTCAAAACACCCCTGTGG - Intergenic
1130154740 15:81340077-81340099 GGATGCCCAGAGCTCCCCTGAGG + Intronic
1132767210 16:1540464-1540486 GCCTCCTCAGAGCACGCCTGTGG - Intronic
1133912467 16:10078535-10078557 GAATCCTCAGAGCACCTGGCAGG + Intronic
1134331437 16:13254746-13254768 GAATCCTCAGCGGACACCTTGGG + Intergenic
1135233278 16:20729716-20729738 GAATCCTAATAGCTCCCCTTTGG - Intronic
1137587829 16:49674721-49674743 AAGGCCTCAGAGCATCCCTGTGG - Intronic
1138436756 16:57005062-57005084 GAATCCCCAGTGCACCCCTGAGG - Intronic
1138530507 16:57631847-57631869 GAATCTACAGGGCTCCCCTGGGG - Intronic
1138785206 16:59837591-59837613 GAATACTCACACCAACCCTGTGG + Intergenic
1139344969 16:66296896-66296918 GAGTCCTGAGAGCACCCCAGGGG - Intergenic
1139516988 16:67458082-67458104 GAACCCTCAGCTCACCCATGAGG + Intronic
1141422930 16:83928628-83928650 CAATCCTCAAAGCAGCCTTGTGG + Intronic
1141433225 16:83981551-83981573 TAATCCTCACAGCAACCCTATGG + Intronic
1141500771 16:84442835-84442857 GAATCCTATGAGCTTCCCTGTGG + Intronic
1142149416 16:88506097-88506119 CAAACCTCAGAGCACCCTGGAGG - Intronic
1142271000 16:89089240-89089262 GACTCCTCACCGCACTCCTGAGG + Intronic
1143203734 17:5129358-5129380 GGGTCCTCAGAACACACCTGGGG + Intronic
1143385300 17:6525872-6525894 TAATCCTCACAACACCTCTGTGG - Intronic
1144795407 17:17888057-17888079 GAAGCCTGAGAGCAGCACTGAGG + Intronic
1144874914 17:18392469-18392491 GGGTCCTCAGAACACACCTGGGG + Intergenic
1145157311 17:20551952-20551974 GGGTCCTCAGAACACACCTGGGG - Intergenic
1145992476 17:29087312-29087334 TCATCCTCAGAAGACCCCTGGGG - Intronic
1147565016 17:41530642-41530664 GGATCCTCACAGCAGCCCAGTGG + Intergenic
1147576047 17:41599660-41599682 TAATCCTCAGAGCAACACTAAGG + Intergenic
1149434698 17:56623211-56623233 GAATCCTCACAACAGCCTTGTGG - Intergenic
1150107004 17:62469647-62469669 AAGGCTTCAGAGCACCCCTGGGG + Intronic
1150173480 17:63024250-63024272 TACTCCTTAGAGCAGCCCTGAGG + Intronic
1151329784 17:73399947-73399969 TAATCCTCACAACAACCCTGAGG - Intronic
1151693815 17:75703820-75703842 GAGTCCTCAGACCAGCCATGGGG - Exonic
1151831569 17:76555343-76555365 TACTCCACAGAGCAGCCCTGAGG + Intergenic
1152537819 17:80960651-80960673 GCCTCCACTGAGCACCCCTGTGG + Intronic
1152537838 17:80960738-80960760 GCCTCCACTGAGCACCCCTGTGG + Intronic
1152729895 17:81964493-81964515 GAAGCCCCAGAGCATCGCTGTGG + Intergenic
1154065960 18:11107187-11107209 TAATCCTCACAGCAACCCTACGG - Intronic
1157159516 18:45300704-45300726 TAATCCTCTGAGCATCTCTGAGG + Intronic
1161294373 19:3512241-3512263 GCATCCACTGAGCACCTCTGGGG + Intronic
1162398213 19:10430259-10430281 GGATTCTCAGGGCACTCCTGGGG + Intronic
1163095263 19:15052719-15052741 GAATGCTCAGAACACTCTTGGGG + Intronic
1163290471 19:16376421-16376443 GAATCCTCAGGGGACCCTCGAGG + Intronic
1165706014 19:37976708-37976730 GAATCCTCAAAGCAACCCTCCGG - Intronic
1166656076 19:44613086-44613108 GAATCCTCATAGCAACCTCGAGG - Intergenic
926136281 2:10338960-10338982 TAATTCTCAAAGCAGCCCTGTGG + Intronic
927574874 2:24192586-24192608 GACTCCATAGAGCAGCCCTGAGG + Intronic
928344946 2:30483510-30483532 AAATCCTCAGAACAACCCTATGG - Intronic
929928583 2:46234762-46234784 TAATCCTCCTAGCATCCCTGGGG - Intergenic
930025090 2:47024889-47024911 GCATTCTCTCAGCACCCCTGGGG - Intronic
931212574 2:60212007-60212029 GAATTCTGAGAACAACCCTGAGG - Intergenic
931592416 2:63899911-63899933 TAATCCTCACAGCAGCCCTTTGG - Intronic
932406238 2:71514024-71514046 GGATCCTCAGGGCCCTCCTGTGG + Intronic
932599553 2:73113870-73113892 TTATCCTCAGAGCAACTCTGTGG + Intronic
932819202 2:74885242-74885264 TAACCCTCACAGCACCCTTGTGG - Intronic
933331679 2:80900171-80900193 TAATCCTCACAACAGCCCTGTGG + Intergenic
933773009 2:85755508-85755530 GATTCCTGAGCCCACCCCTGGGG - Intronic
933970974 2:87469403-87469425 TTACCCTCAGAGCACCCATGAGG + Intergenic
935332856 2:101989766-101989788 GAATCCTCTGAAAACCCTTGTGG - Intergenic
939403525 2:141727234-141727256 CAATCCTCAGAGAGGCCCTGTGG + Intronic
941402367 2:165046392-165046414 TAATCCTCACAGCAGCCCTAGGG + Intergenic
944077692 2:195750735-195750757 GAATCCTCACAATACCCCTATGG - Intronic
945885952 2:215375647-215375669 CAATGCTCGGAGCTCCCCTGTGG - Exonic
948336242 2:237209432-237209454 GATTTCTCAGTGCACCCCTCAGG + Intergenic
1169340134 20:4790241-4790263 GAAGCCTCAAAGTCCCCCTGTGG - Intronic
1169558648 20:6775185-6775207 AAATCATCACAGCAACCCTGAGG - Intronic
1170624592 20:18021574-18021596 GAATCCTCAGAGCACCCCTGGGG - Intronic
1171781602 20:29423710-29423732 TAATCCTCATAGCACCCTGGGGG - Intergenic
1172072750 20:32270493-32270515 AAACCCTCACAGCAGCCCTGAGG + Intergenic
1172376602 20:34446919-34446941 GAATCCTCAGAAAAACTCTGAGG - Intronic
1173291867 20:41722386-41722408 GAGTCATCAAAGCACTCCTGGGG - Intergenic
1173502404 20:43563920-43563942 GAACCCACAGAGAACCCCTGAGG + Intronic
1175774445 20:61644296-61644318 TAATCATCGGAGCACTCCTGAGG + Intronic
1175964385 20:62653198-62653220 GATTCCACAGAGGAGCCCTGTGG + Intronic
1178624422 21:34203210-34203232 GAATCCACGGAGAAGCCCTGAGG + Intergenic
1178669179 21:34575861-34575883 TAATCCTCAGGACAGCCCTGAGG + Intronic
1178945715 21:36946060-36946082 GAACCATAAGAGCACCCTTGTGG - Intronic
1179053455 21:37909701-37909723 GAATCCTCATAACATCTCTGAGG + Intronic
1179233272 21:39524348-39524370 GACTTCTCTGAGGACCCCTGTGG + Intergenic
1179237472 21:39560348-39560370 GAATCCTCATATCACCCCTGTGG - Intronic
1179383901 21:40924248-40924270 GAATCCAAAGAGCAGCCCTCGGG + Intergenic
1179423466 21:41254251-41254273 GAAACCTTAGAGCTCCCCTGTGG - Intronic
1179444595 21:41422403-41422425 TACTCCACAGAGCAACCCTGAGG - Intronic
1179777206 21:43672892-43672914 TAATATTCAGAGCACCACTGGGG - Intronic
1180031430 21:45211109-45211131 AAAGCCTGAGAGCAGCCCTGGGG + Intronic
1182172735 22:28249259-28249281 TAATCCTCAGAGCTACCCAGTGG - Intronic
1182444859 22:30384194-30384216 GAACACTCACAGCACTCCTGTGG + Intronic
1182744770 22:32597108-32597130 CAATCCTCACAGCAACCCCGTGG - Intronic
1183257794 22:36773864-36773886 GAATCCTCATAGCAACCCTGTGG - Intronic
1184683322 22:46084800-46084822 CAGTCCTCAGACCACACCTGGGG + Intronic
1184706185 22:46215041-46215063 TAAACCTCAGAACACCCATGCGG - Intronic
1184740784 22:46427943-46427965 GTACCCCCGGAGCACCCCTGGGG - Intronic
1185050341 22:48551026-48551048 GTGCCCTCAGAGCAGCCCTGGGG - Intronic
1185087401 22:48748388-48748410 GTCTCCTCACTGCACCCCTGGGG - Intronic
949914901 3:8952717-8952739 CGATCCTCACAGCAACCCTGAGG + Intronic
950518274 3:13481039-13481061 CAGTCCTCACAGCAGCCCTGGGG - Intronic
950667748 3:14507450-14507472 GAGTCCTCACTGCAGCCCTGTGG - Intronic
950790469 3:15467588-15467610 GACTCCTAAGAGCAACCCTGAGG - Intronic
952906668 3:38143656-38143678 GTGTACTCAGAGAACCCCTGAGG + Intergenic
953643192 3:44728755-44728777 TAATCCTCACAACAACCCTGTGG + Intergenic
954044608 3:47918790-47918812 GCTTCCACAGACCACCCCTGAGG + Exonic
955038501 3:55292435-55292457 GAAGGCACACAGCACCCCTGAGG + Intergenic
955515845 3:59725770-59725792 TACTCCACAGAGCAGCCCTGAGG + Intergenic
955838215 3:63081850-63081872 TAATCCTCACAACAACCCTGTGG + Intergenic
955905908 3:63807333-63807355 TAATCCTCACAACAACCCTGGGG + Intergenic
956406248 3:68931930-68931952 GCATCAGCAGAGCACCCCCGGGG + Intronic
960640319 3:119816992-119817014 GCAGCCTCAGAGCAGCCCTGAGG + Intronic
962971370 3:140404771-140404793 GTGACCTCAGAGGACCCCTGTGG + Intronic
964039253 3:152238848-152238870 TAATCCTCACAGTACCCCAGTGG + Intergenic
965346389 3:167556300-167556322 TAATCCTCCAAGCATCCCTGAGG - Intronic
966559318 3:181301873-181301895 GAAACCTCACAGCAACCTTGAGG - Intergenic
967303364 3:188038243-188038265 TACTCCTCTGAGCAGCCCTGGGG + Intergenic
968234124 3:197021697-197021719 TCATCCTCAGAGCAGCCCTGTGG - Intronic
968925704 4:3546685-3546707 GAATCCTCAGAATTTCCCTGTGG + Intergenic
970381053 4:15508188-15508210 GACTCCTCAGAGGATCCCTGTGG + Intronic
971341063 4:25769553-25769575 GAATCCTCAGAGCAGACCCAAGG + Intronic
972226874 4:37023749-37023771 TAATCCTCAGAACAACCCAGAGG + Intergenic
984953617 4:185024453-185024475 GAATCCTCATAGCAACCCCAGGG - Intergenic
985492257 5:186822-186844 GAATCCCCACACCATCCCTGGGG - Exonic
985723142 5:1501239-1501261 GAAGCCTCAGAGCAGGACTGTGG + Intronic
985827834 5:2205726-2205748 GAATCCTCAGAGTCATCCTGAGG + Intergenic
987837363 5:23178911-23178933 GATTCCTCAGAGCCCGCCGGGGG + Intergenic
992610696 5:78505847-78505869 TAATCCTCAGAACAGTCCTGAGG + Intronic
994427454 5:99608991-99609013 GAATGTTCATAGCACCACTGTGG - Intergenic
995821745 5:116242445-116242467 AAATCCTCTCAGCAACCCTGAGG + Intronic
997446094 5:133941481-133941503 GAATCCACAAAGCACCCATGAGG - Intergenic
997624613 5:135323467-135323489 GACTGCTCAGGGCACCCCAGAGG - Intronic
997648843 5:135499950-135499972 TAATCCTCAAAGCAACCTTGTGG - Intergenic
998303653 5:141051893-141051915 GATTCCGGAGAGCACCCCTTTGG + Exonic
998448539 5:142216982-142217004 GGATCCTCATAGCATCCCTAAGG + Intergenic
999654534 5:153799148-153799170 GAGTCTTCTGAGCACCCCTCAGG - Intronic
999767889 5:154755142-154755164 GATTCCTCAGAGCACCTCCCGGG - Intronic
1001522551 5:172404983-172405005 TGCTCCTCAGAGCAGCCCTGCGG - Intronic
1001720170 5:173850694-173850716 GAAGCCTCAGAGCCCCACTCCGG - Intergenic
1002110207 5:176903897-176903919 TAATCCTCATAGCAACCCTATGG - Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1006036308 6:31215500-31215522 CCATCAACAGAGCACCCCTGAGG - Intergenic
1006153270 6:32000680-32000702 CCTTCCTCAGAGCTCCCCTGTGG - Intronic
1006159578 6:32033417-32033439 CCTTCCTCAGAGCTCCCCTGTGG - Intronic
1010443645 6:75927512-75927534 GGACCCTCAGAGCACTGCTGTGG + Intronic
1018105668 6:160483909-160483931 GAATCCTCAGGGCACTCTGGGGG - Intergenic
1019440314 7:1042692-1042714 CCAGCCACAGAGCACCCCTGTGG + Intronic
1020194035 7:6023255-6023277 GCATCACCAGAGCAGCCCTGAGG - Exonic
1020211023 7:6158402-6158424 GAATCTTCAGGGCTGCCCTGAGG + Intronic
1021469291 7:20983031-20983053 TAATCCTCATAGTAACCCTGTGG - Intergenic
1023996287 7:45161039-45161061 GCATCCTCATAGCACCTCCGTGG + Intronic
1024053324 7:45643876-45643898 GATTCCTCAGTCCTCCCCTGAGG + Intronic
1024554155 7:50589006-50589028 GCCTCCCAAGAGCACCCCTGTGG - Intergenic
1024662980 7:51516892-51516914 GAGTCCTCAGTGCAGCTCTGAGG + Intergenic
1027657916 7:80954341-80954363 GAATCACCAGAGCATGCCTGAGG + Intergenic
1029934879 7:104413469-104413491 TAATCCTCAGAACAACCCTATGG + Intronic
1031239545 7:119219893-119219915 GAATCCTGGGACTACCCCTGGGG + Intergenic
1032036055 7:128522195-128522217 AAGGCTTCAGAGCACCCCTGGGG + Intergenic
1034551196 7:151821865-151821887 TAATCCTCACAGTAACCCTGTGG - Intronic
1035372250 7:158386972-158386994 CCATCCTCAGCCCACCCCTGTGG - Intronic
1036028951 8:4944248-4944270 GAATCCTCAGAGCTCTGTTGAGG - Intronic
1036749860 8:11436722-11436744 GAGCCCTCAGAAGACCCCTGGGG + Intronic
1038159504 8:25023269-25023291 TTCTCCTCAGAGCACCACTGTGG + Intergenic
1041871624 8:62640743-62640765 GATTCCTCTGAGCACCCCAGAGG + Intronic
1044949847 8:97425121-97425143 TAATTCTCAGAAAACCCCTGTGG - Intergenic
1045035053 8:98170235-98170257 GAAACCTCCGTGCAGCCCTGGGG + Intergenic
1045098600 8:98824043-98824065 TAATCCTCACAGCAACCCTATGG - Intronic
1046504533 8:115120372-115120394 AAATCATCAGTGCATCCCTGGGG + Intergenic
1048555665 8:135473472-135473494 ATATCCTCAGAGTACCCCCGAGG - Intronic
1049195981 8:141315835-141315857 GGAGCCTCTGAGCAGCCCTGTGG + Intergenic
1049385095 8:142339144-142339166 AAATCCACAGAGCACCACTAGGG + Intronic
1049873508 8:145000203-145000225 GAAGTCTCAGAGCACCTATGGGG - Intergenic
1051113564 9:13668028-13668050 AAATCCTCACAGCAGCCCTGTGG - Intergenic
1052663888 9:31469950-31469972 GAATAGACAGAGCAGCCCTGAGG + Intergenic
1053053617 9:34980618-34980640 TAATCCCCAGAGCCCCTCTGCGG + Exonic
1053800585 9:41761864-41761886 GAATCCTCAGAATTTCCCTGTGG + Intergenic
1054189016 9:61974016-61974038 GAATCCTCAGAATTTCCCTGTGG + Intergenic
1054464292 9:65483929-65483951 GAATCCTCAGAATTTCCCTGTGG - Intergenic
1054649501 9:67614601-67614623 GAATCCTCAGAATTTCCCTGTGG - Intergenic
1054870543 9:70044255-70044277 GAGTCGTCAGAGCGCCCCCGGGG - Intronic
1057224788 9:93287219-93287241 GCAGCCTCTGAGCACCCCTAGGG - Intronic
1058163157 9:101592416-101592438 GAATCCTCAAAATAACCCTGGGG + Exonic
1059065334 9:111077867-111077889 TAATCCTCACAGCAACACTGTGG - Intergenic
1059531980 9:115043543-115043565 TAATCCTCAAAACATCCCTGTGG - Intronic
1060274741 9:122173888-122173910 TAATCCTGAGAGCAGCTCTGTGG - Intronic
1060341231 9:122778775-122778797 GAATTTTCAGAGCAGTCCTGAGG + Intergenic
1060418347 9:123449173-123449195 TAATCCTCAGAACAGCCCTGTGG - Intronic
1060853125 9:126894040-126894062 GCATCCTCAGAACAACTCTGAGG + Intergenic
1061945539 9:133906599-133906621 GGAGCCTCAAGGCACCCCTGAGG + Intronic
1062475068 9:136722663-136722685 GAAGCCTCAGAGCTTCCCTGAGG - Intronic
1186500435 X:10046365-10046387 GAATCCTCAGAGCAGGACTGTGG - Intronic
1186602361 X:11051439-11051461 GAATGCTGAGAGGAGCCCTGGGG - Intergenic
1187047924 X:15666270-15666292 TAATTCTCAGAGCATCTCTGAGG - Intergenic
1187053654 X:15719020-15719042 TAATTCTCAGAGCATCTCTGAGG - Intronic
1187359048 X:18607292-18607314 GAATGGTCAGAGGAGCCCTGAGG + Intronic
1187782421 X:22842935-22842957 TAATCCTCAGAACAACCTTGGGG - Intergenic
1188369721 X:29353942-29353964 GAATCCTCAGAAAACCTATGAGG + Intronic
1189150715 X:38703634-38703656 GAATCCTGAGAGCATGCCAGGGG - Intergenic
1189346736 X:40247619-40247641 TAATCCTCACAGCAACCTTGTGG - Intergenic
1189401058 X:40669140-40669162 TAATCCTCACAGCAAACCTGTGG - Intronic
1190358392 X:49626942-49626964 GCATCCTCAGCTCACTCCTGGGG + Intergenic
1192268470 X:69556461-69556483 GAATCATCAGAGAAACCCAGGGG + Intergenic
1193751224 X:85346696-85346718 TACTCCTCATAGCACCCCTATGG - Intronic
1194958007 X:100203575-100203597 GAACCCTCAGAGGGCACCTGAGG + Intergenic
1195343582 X:103927007-103927029 GAATGCTCAGAGCAGATCTGAGG - Intronic
1195883599 X:109618204-109618226 CAATCTTCACAGCAACCCTGGGG + Intergenic
1197772066 X:130095526-130095548 GAAGCCTCAGAGCCCCTGTGGGG + Intronic
1198936478 X:141905695-141905717 GAATTCTCAGAGTTCTCCTGAGG + Exonic
1198936486 X:141905743-141905765 GATTTCTCAGAGCCCTCCTGAGG + Exonic
1198936762 X:141907387-141907409 TAGTCCTCAGAGCCCTCCTGAGG + Exonic
1198936821 X:141907687-141907709 GAGTCCTCAGAGTCCTCCTGAGG + Exonic
1198936836 X:141907792-141907814 GAGTCCTCAGAGTCCTCCTGAGG + Exonic
1199806672 X:151307017-151307039 GCATCCTCAGACCAGCCCTGTGG + Intergenic
1201793563 Y:17869394-17869416 GATGCCTCAGAGAGCCCCTGGGG + Intergenic
1201807991 Y:18036592-18036614 GATGCCTCAGAGAGCCCCTGGGG - Intergenic
1202354946 Y:24037211-24037233 GATGCCTCAGAGAGCCCCTGGGG + Intergenic
1202515832 Y:25632898-25632920 GATGCCTCAGAGAGCCCCTGGGG - Intergenic