ID: 1170628075

View in Genome Browser
Species Human (GRCh38)
Location 20:18044659-18044681
Sequence GCCTGCACCCCCACTAGACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 79}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170628075_1170628080 13 Left 1170628075 20:18044659-18044681 CCGAGTCTAGTGGGGGTGCAGGC 0: 1
1: 0
2: 0
3: 10
4: 79
Right 1170628080 20:18044695-18044717 TTGACATCTGAGAGGCCCAGGGG 0: 1
1: 0
2: 1
3: 14
4: 178
1170628075_1170628078 11 Left 1170628075 20:18044659-18044681 CCGAGTCTAGTGGGGGTGCAGGC 0: 1
1: 0
2: 0
3: 10
4: 79
Right 1170628078 20:18044693-18044715 CATTGACATCTGAGAGGCCCAGG 0: 1
1: 0
2: 2
3: 21
4: 195
1170628075_1170628079 12 Left 1170628075 20:18044659-18044681 CCGAGTCTAGTGGGGGTGCAGGC 0: 1
1: 0
2: 0
3: 10
4: 79
Right 1170628079 20:18044694-18044716 ATTGACATCTGAGAGGCCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 150
1170628075_1170628083 22 Left 1170628075 20:18044659-18044681 CCGAGTCTAGTGGGGGTGCAGGC 0: 1
1: 0
2: 0
3: 10
4: 79
Right 1170628083 20:18044704-18044726 GAGAGGCCCAGGGGTCCGAGGGG 0: 1
1: 0
2: 1
3: 30
4: 301
1170628075_1170628076 5 Left 1170628075 20:18044659-18044681 CCGAGTCTAGTGGGGGTGCAGGC 0: 1
1: 0
2: 0
3: 10
4: 79
Right 1170628076 20:18044687-18044709 AACAGCCATTGACATCTGAGAGG 0: 1
1: 0
2: 2
3: 9
4: 149
1170628075_1170628084 23 Left 1170628075 20:18044659-18044681 CCGAGTCTAGTGGGGGTGCAGGC 0: 1
1: 0
2: 0
3: 10
4: 79
Right 1170628084 20:18044705-18044727 AGAGGCCCAGGGGTCCGAGGGGG 0: 1
1: 0
2: 2
3: 37
4: 323
1170628075_1170628081 20 Left 1170628075 20:18044659-18044681 CCGAGTCTAGTGGGGGTGCAGGC 0: 1
1: 0
2: 0
3: 10
4: 79
Right 1170628081 20:18044702-18044724 CTGAGAGGCCCAGGGGTCCGAGG 0: 1
1: 1
2: 2
3: 44
4: 331
1170628075_1170628082 21 Left 1170628075 20:18044659-18044681 CCGAGTCTAGTGGGGGTGCAGGC 0: 1
1: 0
2: 0
3: 10
4: 79
Right 1170628082 20:18044703-18044725 TGAGAGGCCCAGGGGTCCGAGGG 0: 1
1: 0
2: 0
3: 17
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170628075 Original CRISPR GCCTGCACCCCCACTAGACT CGG (reversed) Intronic
900639289 1:3681204-3681226 GCCTGCACCCCCGCTGGCCGTGG + Intronic
901877917 1:12177466-12177488 GGCTGCACCCCCACTAGTGTGGG + Intronic
903786977 1:25867842-25867864 TCCTGCTTCCCCACTGGACTAGG - Intronic
903832503 1:26183466-26183488 GCCTCCCCACCCACCAGACTTGG - Intronic
906528958 1:46512365-46512387 GCCTGCACCCCCAGCAGGCCTGG + Exonic
922792641 1:228318559-228318581 GCCAGCACCCCCATAAGTCTAGG + Intronic
1066321201 10:34305717-34305739 GCCTGCAATCCTAGTAGACTGGG + Intronic
1067711955 10:48656748-48656770 GCCTACACCGCCCGTAGACTGGG + Intergenic
1073969659 10:109032847-109032869 GTCTGTACCCCCACAATACTTGG + Intergenic
1077408374 11:2392584-2392606 GCCTGGGCCCCCACTGGACAGGG + Intronic
1083959549 11:66007050-66007072 GCCTGGCCACCCACTAGCCTGGG + Intergenic
1084096103 11:66912694-66912716 TCCTGCTTCCCCACTAGAGTGGG + Intronic
1085444510 11:76591531-76591553 GGGTGCACCCCCCCTTGACTTGG - Intergenic
1088918509 11:114244863-114244885 GCCTTCACCCCCACCCGGCTGGG + Intronic
1095890908 12:47234783-47234805 GCCTGAACTGCCACTAGACAAGG + Intronic
1102738607 12:115185861-115185883 GCCTTCACCCCCATCAGCCTGGG - Intergenic
1106115128 13:26811293-26811315 GAATGCACTCCCACCAGACTGGG - Intergenic
1114907840 14:27152276-27152298 GCCTGCACAGCCACACGACTGGG + Intergenic
1121103352 14:91264709-91264731 ACCTGCACCCCCACCGGCCTGGG + Intergenic
1121571460 14:94949711-94949733 GCCTGTTCCCCCACTGGACTGGG - Intergenic
1123108970 14:105856430-105856452 GCCTGCAGCCCCAGCAGCCTTGG - Intergenic
1124823847 15:33073988-33074010 GCCTGTAGCCCCAGTACACTGGG - Intronic
1125578966 15:40772600-40772622 GCCTGCCCCTCCACTTGACTGGG - Intronic
1125854116 15:42932775-42932797 GCCTGCAATCCCACTAGTTTGGG + Intergenic
1125967607 15:43886932-43886954 GCCTGCACCCACACTGGAAATGG - Intronic
1135743106 16:24993650-24993672 GCCTGCACACCCACGAAACAGGG - Intronic
1141530519 16:84643418-84643440 GCCTCCTCCCCCAGGAGACTCGG + Intergenic
1142281098 16:89147955-89147977 GCCTGCACCCCCACTGTATCTGG - Intronic
1145260232 17:21350397-21350419 GCCTGCCGCCCCACCAGGCTGGG - Intergenic
1145316387 17:21737543-21737565 GCCTGCCGCCCCACCAGGCTGGG + Intergenic
1145714816 17:27009463-27009485 GCCTGCCGCCCCACCAGGCTGGG + Intergenic
1146143322 17:30388460-30388482 GCCTGGGCCCCCACCGGACTGGG - Intronic
1146349409 17:32083066-32083088 GCCTGGACCCCCACTCCTCTAGG - Intergenic
1149078734 17:52629412-52629434 GCCAGCTTCCTCACTAGACTGGG + Intergenic
1149194417 17:54102468-54102490 GACTGCATCCCCACAAGACTGGG + Intergenic
1150075541 17:62188772-62188794 GCCAACACCCCCAGCAGACTGGG + Intergenic
1153791873 18:8586404-8586426 GCCTGCACCCCCAGGATGCTGGG + Intergenic
1155253469 18:23973155-23973177 GCCTTCACCCCAACAAGATTAGG + Intergenic
1161217154 19:3100260-3100282 GCCTCCACCCACACCAGACCAGG + Intronic
1161504056 19:4634544-4634566 GCCTGAAGCCCCTCTAGACTAGG - Intergenic
1162728906 19:12706028-12706050 TCTTTCTCCCCCACTAGACTGGG + Intronic
1164721380 19:30434077-30434099 GCCTGCTCTCCCACTAGAATCGG - Intronic
926416864 2:12657847-12657869 GCCTGCACCACCCCTATACCAGG - Intergenic
929712757 2:44281281-44281303 GCCTGTAACCCCAATACACTGGG - Intronic
933799048 2:85945136-85945158 TCCTCCTCCCCAACTAGACTTGG + Intergenic
935402584 2:102675644-102675666 GCCTGCACACTAACTAGTCTAGG + Intronic
937408949 2:121656016-121656038 GCCTGCACACACACCAGCCTGGG - Intergenic
937927292 2:127176998-127177020 TCCTGGAACCCCACTAAACTGGG + Intergenic
941874354 2:170418070-170418092 TCCTGCACACCCACTGGACTGGG - Intronic
947704369 2:232262420-232262442 GCTGGCACCACCACTAAACTTGG + Intronic
1170465930 20:16622499-16622521 GCCTCCACCCTCCCTAGACCAGG - Intergenic
1170628075 20:18044659-18044681 GCCTGCACCCCCACTAGACTCGG - Intronic
1172866721 20:38105577-38105599 GCCTGAGCCCCCACCACACTGGG - Intronic
1173252263 20:41370225-41370247 TCCTCCACCCCCACTAGAATGGG - Intergenic
1173924576 20:46771269-46771291 GTCTGCACCCCCTCCAGCCTGGG - Intergenic
1176841624 21:13847523-13847545 CCCTGCACCCTCACTAGCCAGGG - Intergenic
1182480335 22:30604717-30604739 GCCTGTGCTCCCACTAGACTGGG - Intronic
1183354711 22:37351947-37351969 GCCTGGCCCCCGAGTAGACTGGG + Intergenic
1184006765 22:41715876-41715898 TCCAGCTCCCCCACTGGACTGGG - Intronic
1184250579 22:43257998-43258020 GCCTGCAGCCCCCCAAGACCAGG - Intronic
955833153 3:63026151-63026173 GCCTGTACCCCCACTGTACTTGG - Intergenic
965739626 3:171860488-171860510 GCCTGCATTCCCAATAGTCTGGG - Intronic
974192827 4:58529617-58529639 TCCTGCACCCCCAGCACACTTGG + Intergenic
975560980 4:75708219-75708241 CCCTTCTTCCCCACTAGACTTGG + Intronic
978210793 4:106132915-106132937 GCCTGTACCCCCACTGTATTTGG + Intronic
980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG + Intronic
982670427 4:158313987-158314009 GCCTGCTTCCCCACAGGACTAGG - Intergenic
985990919 5:3560584-3560606 GCCTCCACTCCCACAACACTGGG + Intergenic
986062108 5:4201588-4201610 GCCTGCACACCCAGGAGAATTGG + Intergenic
1001143671 5:169165812-169165834 AAGTGCACCCCCACTAGAATGGG + Intronic
1002342579 5:178526696-178526718 GCCTGAACCCCCTCTATCCTTGG - Intronic
1007820050 6:44554499-44554521 CACTGCAGCCCTACTAGACTGGG - Intergenic
1010186379 6:73148572-73148594 GCCTGCAACCACAATAAACTAGG - Intronic
1011639544 6:89406288-89406310 GGCTGCACCCCCACAGGCCTAGG + Intronic
1020669711 7:11091610-11091632 GCATGCACCACCACCACACTCGG - Intronic
1023332861 7:39137836-39137858 GCCTGCACCCCCAAGAAGCTTGG - Intronic
1023808577 7:43892877-43892899 GAATGCATCACCACTAGACTCGG + Intronic
1028324806 7:89509405-89509427 CCCTATAACCCCACTAGACTTGG - Intergenic
1031511827 7:122659963-122659985 GACTGCATCACCACTAGTCTTGG + Intronic
1035741455 8:1930978-1931000 GTCTGCACCCCCTCTTCACTTGG + Intronic
1037735763 8:21564570-21564592 GCATGTACCCACCCTAGACTGGG - Intergenic
1040892188 8:52328883-52328905 GCCAGCACCCCCAATAGATGTGG - Intronic
1046181618 8:110656214-110656236 TCCTGCACCCCCAACAGAGTGGG + Intergenic
1056935346 9:90911784-90911806 GCCTGCACCTCCTCCAGTCTGGG + Intergenic
1057298996 9:93865719-93865741 CTCTCCACCCCCACTTGACTGGG + Intergenic
1058705613 9:107635861-107635883 GCCTGCTCTCCCACTGGTCTAGG - Intergenic
1059723154 9:116981156-116981178 GCCTGTTCCCCCACTAAGCTGGG + Intronic
1061729782 9:132604845-132604867 GCCTCCACCCCACCTAGACAAGG - Intronic
1061896851 9:133652681-133652703 AGCTGCACCCCCACTGGCCTGGG + Intronic
1190160122 X:48026182-48026204 GCCTGGAGCCCCACTAGGCAGGG + Intronic