ID: 1170629946

View in Genome Browser
Species Human (GRCh38)
Location 20:18057519-18057541
Sequence ATCCCAGGTGAGCGCGCGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170629946_1170629952 5 Left 1170629946 20:18057519-18057541 CCCCGCGCGCGCTCACCTGGGAT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1170629952 20:18057547-18057569 TGTCTGCCCTTTTCTCATCCGGG 0: 1
1: 0
2: 0
3: 25
4: 273
1170629946_1170629956 23 Left 1170629946 20:18057519-18057541 CCCCGCGCGCGCTCACCTGGGAT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1170629956 20:18057565-18057587 CCGGGAGCTCATCCCAGCTGCGG 0: 1
1: 0
2: 0
3: 12
4: 184
1170629946_1170629951 4 Left 1170629946 20:18057519-18057541 CCCCGCGCGCGCTCACCTGGGAT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1170629951 20:18057546-18057568 GTGTCTGCCCTTTTCTCATCCGG 0: 1
1: 0
2: 0
3: 19
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170629946 Original CRISPR ATCCCAGGTGAGCGCGCGCG GGG (reversed) Exonic