ID: 1170635147

View in Genome Browser
Species Human (GRCh38)
Location 20:18097976-18097998
Sequence CATTGCATGTGTGTCTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170635147_1170635149 17 Left 1170635147 20:18097976-18097998 CCTGGAGAGACACACATGCAATG No data
Right 1170635149 20:18098016-18098038 CTCACCCAGTGCTCTGTCATTGG No data
1170635147_1170635153 24 Left 1170635147 20:18097976-18097998 CCTGGAGAGACACACATGCAATG No data
Right 1170635153 20:18098023-18098045 AGTGCTCTGTCATTGGACCAGGG No data
1170635147_1170635152 23 Left 1170635147 20:18097976-18097998 CCTGGAGAGACACACATGCAATG No data
Right 1170635152 20:18098022-18098044 CAGTGCTCTGTCATTGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170635147 Original CRISPR CATTGCATGTGTGTCTCTCC AGG (reversed) Intergenic
No off target data available for this crispr