ID: 1170635152

View in Genome Browser
Species Human (GRCh38)
Location 20:18098022-18098044
Sequence CAGTGCTCTGTCATTGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170635147_1170635152 23 Left 1170635147 20:18097976-18097998 CCTGGAGAGACACACATGCAATG No data
Right 1170635152 20:18098022-18098044 CAGTGCTCTGTCATTGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170635152 Original CRISPR CAGTGCTCTGTCATTGGACC AGG Intergenic
No off target data available for this crispr