ID: 1170635287

View in Genome Browser
Species Human (GRCh38)
Location 20:18099119-18099141
Sequence GCCTCACCCTTGGTGTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170635282_1170635287 17 Left 1170635282 20:18099079-18099101 CCGAGGTCTGGCTGGAACAATTC No data
Right 1170635287 20:18099119-18099141 GCCTCACCCTTGGTGTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170635287 Original CRISPR GCCTCACCCTTGGTGTTGCC TGG Intergenic
No off target data available for this crispr