ID: 1170637653

View in Genome Browser
Species Human (GRCh38)
Location 20:18122460-18122482
Sequence AGACATGGCAAAAGTGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170637653_1170637656 17 Left 1170637653 20:18122460-18122482 CCGGCCACACTTTTGCCATGTCT No data
Right 1170637656 20:18122500-18122522 AAGTTCTAGCCAGAGCAATTAGG 0: 80
1: 619
2: 5773
3: 10912
4: 6838
1170637653_1170637657 22 Left 1170637653 20:18122460-18122482 CCGGCCACACTTTTGCCATGTCT No data
Right 1170637657 20:18122505-18122527 CTAGCCAGAGCAATTAGGCAAGG 0: 16
1: 66
2: 202
3: 344
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170637653 Original CRISPR AGACATGGCAAAAGTGTGGC CGG (reversed) Intergenic
No off target data available for this crispr