ID: 1170640769

View in Genome Browser
Species Human (GRCh38)
Location 20:18150689-18150711
Sequence CAGAGCGAACAAAGGACGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 299}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170640769 Original CRISPR CAGAGCGAACAAAGGACGGA CGG (reversed) Intronic
900827382 1:4937664-4937686 CAGAGGGAAGGAAGGAGGGAGGG + Intergenic
901937807 1:12638966-12638988 CAGAGAGAAGGAAGGAAGGAAGG - Intergenic
902130531 1:14256499-14256521 CAGAGAGAGGAAAGGAGGGAGGG + Intergenic
902421871 1:16287131-16287153 CAGAGTGAACAAAGGAGAGGAGG - Intronic
902737673 1:18411998-18412020 CACACCGAACAAAGGAGAGAAGG - Intergenic
903838743 1:26223255-26223277 CATAGAGAATAAAGGGCGGACGG - Intergenic
904942137 1:34171272-34171294 CAGAGAGAACAAAACACAGAAGG - Intronic
905137890 1:35814108-35814130 GAGAGAGAAAAAAGGAAGGAAGG + Intronic
905749064 1:40445844-40445866 CACACTGAACAAAGGAGGGAAGG - Intergenic
905815138 1:40944229-40944251 CACAGCGAAGAAAGGGAGGATGG - Intergenic
906430684 1:45753562-45753584 CACACCAAACAAAGGAGGGAAGG + Intergenic
906431971 1:45762322-45762344 CACACCAAACAAAGGAGGGAAGG + Intergenic
906659945 1:47574946-47574968 TAGAGCCACCAAAGGACGCACGG - Intergenic
907144055 1:52217141-52217163 CACACCGAACAAAGGAAGGAAGG + Intronic
911362986 1:96902102-96902124 CACACGGAACAAAGGAGGGAAGG - Intergenic
913423738 1:118703564-118703586 CAGCACAAACAAAGGAAGGATGG + Intergenic
915852775 1:159344317-159344339 CAAAGAGAACCAAGGAGGGAGGG + Intergenic
915930028 1:160054661-160054683 CAGAGCTGACACAGGAAGGAGGG - Intronic
917099265 1:171429319-171429341 CACACTGAACAAAGGAGGGAAGG - Intergenic
918430028 1:184449997-184450019 CAGACAGAACACAAGACGGAGGG + Intronic
918641492 1:186846219-186846241 CAGAGAGAAAAAAGAAAGGACGG + Intronic
920310787 1:205047139-205047161 CAGAGGGGACTAAGGAAGGACGG + Intronic
920888520 1:209957939-209957961 CAGAGAGAAAGAAGGAAGGAGGG - Intronic
923148796 1:231216180-231216202 AAGAGAGAGCAAAGGAGGGAAGG - Exonic
923312593 1:232749231-232749253 CACACGGAACAAAGGAGGGAAGG - Intergenic
923896390 1:238275141-238275163 CACACGGAACAAAGGAGGGAAGG + Intergenic
924133456 1:240937228-240937250 CACACCGAACAAAGGAGGGAAGG - Intronic
1063708318 10:8452616-8452638 AAGAGGGAAGAAAGGAAGGAAGG - Intergenic
1063875864 10:10477698-10477720 AAGAGGGAAGAAAGGAAGGAAGG + Intergenic
1068163907 10:53303602-53303624 AAGAGGGAACAAAGGACAGCAGG + Intergenic
1068895523 10:62195597-62195619 CAGAGGGAATGAAGGAAGGAAGG + Exonic
1069668709 10:70183454-70183476 CAGAGAGAAAGAAGGAAGGAAGG + Intergenic
1069919585 10:71808359-71808381 CAGATGGAAGAAAGGATGGATGG - Intronic
1070343974 10:75523801-75523823 CAGAGAGAAGAAAGGATGCAGGG - Intronic
1070400714 10:76051127-76051149 CAGAGCGACCAGACGGCGGAGGG - Intronic
1071848041 10:89540021-89540043 CAGAGAAAAGAAAGGAAGGAAGG - Intronic
1072794880 10:98347095-98347117 CACACCGAACAAAGGAGGGAAGG + Intergenic
1073680579 10:105699147-105699169 CAGAGGGATGAAAGGAAGGAGGG + Intergenic
1075891360 10:125954009-125954031 CACACCGAACGAAGGAGGGAAGG + Intronic
1076019204 10:127056598-127056620 AAGAGAGAAAAAAGGAGGGAAGG - Intronic
1076111567 10:127863562-127863584 CACACCAAACAAAGGAGGGAAGG - Intergenic
1076328509 10:129646919-129646941 CAGAGGGGAAAGAGGACGGAGGG - Intronic
1076943191 10:133623433-133623455 TGGAGCGAGAAAAGGACGGATGG - Intergenic
1078807929 11:14725449-14725471 CAGAGGGAGGAAAGGAGGGAGGG - Intronic
1079373044 11:19868397-19868419 CAGAAAGCACAAAGGACAGAGGG + Intronic
1080127530 11:28754463-28754485 CAGAGGGAAGAAGGGAAGGAAGG + Intergenic
1080315122 11:30938860-30938882 CCTAGGGAACAAAGGAAGGAGGG - Intronic
1082116974 11:48338951-48338973 CAGAGAGAACAGAGGATCGAAGG - Intergenic
1082739069 11:56890358-56890380 AAGAGCGAAAGAAGGAAGGAAGG + Intergenic
1082927452 11:58564998-58565020 CAGAGTGAACCAAGGACACAGGG + Intronic
1083224663 11:61277156-61277178 AAGAGAGAAAAAAGGAGGGAGGG + Intronic
1085084303 11:73656487-73656509 CTGAGTGAGCAAAGGAAGGAAGG + Intronic
1087166100 11:95004802-95004824 CAGAATGAATAAAGGAAGGAAGG - Intergenic
1087518810 11:99202992-99203014 GAGAGAGAAGAAAGGAAGGAAGG + Intronic
1088527186 11:110769817-110769839 TACAGCTAACAAGGGACGGAAGG + Intergenic
1089100432 11:115958317-115958339 AAGAGGGAAGAAAGGAGGGAAGG - Intergenic
1090580370 11:128152781-128152803 CAGAGCAAAGGAAGGAAGGAAGG + Intergenic
1090873207 11:130766307-130766329 CAGGGCGAACAAAGGAAGAGAGG - Intergenic
1091113805 11:132995453-132995475 CAGAGGGAAGAAGGGAGGGAGGG - Intronic
1091860506 12:3777236-3777258 CAGAGGGAAGGAAGGAGGGAAGG + Intergenic
1092931484 12:13319945-13319967 GACAGAGAACAAAGGAAGGAAGG + Intergenic
1094232437 12:28122463-28122485 AAGAGAGAAGAAAGGAGGGAAGG + Intergenic
1095385551 12:41645909-41645931 GAGAGGGAAGAAAGGAAGGAAGG + Intergenic
1096421661 12:51463942-51463964 CAGAGGGAACAATGGTAGGAAGG - Intronic
1096678823 12:53241633-53241655 CAGTGTGAACAAAGGACTGGAGG + Intergenic
1097995256 12:65881614-65881636 CAGAGGGAGCGAAGGAGGGAGGG + Intronic
1098791857 12:74834302-74834324 AGGAGAGAACAAAGGAAGGAAGG - Intergenic
1098802394 12:74978316-74978338 CAGAGAGATGAAAGGAAGGAAGG + Intergenic
1100773630 12:97950845-97950867 AAGAGGGAAAAAAGGAAGGAAGG + Intergenic
1101383482 12:104235152-104235174 CACACTGAACAAAGGAGGGAAGG + Intronic
1101872090 12:108574408-108574430 GAGAGAGAAGAAAGGAAGGAAGG - Intergenic
1102500506 12:113349004-113349026 CAGAGGGAGCAAGGGAAGGAGGG - Intronic
1102669212 12:114602701-114602723 AAGAGGGAAGAAAGGAAGGAAGG + Intergenic
1104197522 12:126555172-126555194 CAGAGCAAACAAAGATAGGAAGG + Intergenic
1104556903 12:129808743-129808765 CAGAATGAACAAAGGCGGGAAGG + Intronic
1104569496 12:129912568-129912590 AAGACGGAACAAAGGAAGGAAGG + Intergenic
1104657122 12:130581614-130581636 CAAAGAGAACAGAGGAAGGAAGG - Intronic
1104705607 12:130944266-130944288 AGGAGAGAACAAAGGACAGATGG - Intergenic
1105296969 13:19096227-19096249 CAAAGGGAACAAAGGAAGTATGG - Intergenic
1105748484 13:23399641-23399663 CACACCAAACAAAGGAGGGAAGG - Intronic
1109182720 13:59232964-59232986 GAGAGGGAAGAAAGGAAGGAAGG + Intergenic
1109575266 13:64248528-64248550 CAGAATGAACAAAGGAATGAAGG - Intergenic
1110478755 13:75949419-75949441 CAGAGCAAAGAAAGCAGGGAAGG + Intergenic
1111613898 13:90640258-90640280 CAGAGAGAAGGAAGGAAGGAAGG - Intergenic
1111946512 13:94670888-94670910 CAGAGAGAAGGAAGGAAGGAAGG - Intergenic
1113042020 13:106114551-106114573 CAAAGAGAACAAAAGACGAAGGG + Intergenic
1113521325 13:110943525-110943547 AAGGGCAAACAAAGGACTGAGGG + Intergenic
1114202422 14:20534800-20534822 CAGAGGGAAAAAAGTATGGAGGG - Intergenic
1115540925 14:34420776-34420798 CACACCGAACAAAAGAGGGAAGG + Intronic
1117043168 14:51786477-51786499 CACACCGAACAAAGGAGAGAAGG + Intergenic
1118164584 14:63323804-63323826 CAGAGAGAAGGAGGGACGGAGGG - Intergenic
1119587046 14:75845892-75845914 GATAGCGTACAAAGGACAGATGG + Intronic
1119623228 14:76148824-76148846 GAGAGGGAAGAAAGGAAGGAAGG + Intergenic
1119702150 14:76762467-76762489 CAGAGCGGAGAAAAGTCGGAGGG - Exonic
1120239237 14:81930492-81930514 CAGAGGAAACACAGGACTGAAGG + Intergenic
1121487347 14:94328055-94328077 CAGAGGGAAAGAAGGAAGGACGG - Intergenic
1122651277 14:103228495-103228517 CAGAAGGAACAAAGGAGGGGAGG + Intergenic
1123213326 14:106782763-106782785 GAGAGAGAAAAAAGGAAGGAAGG - Intergenic
1125012345 15:34893203-34893225 CACACCGAACAAAGGAGAGAAGG + Intronic
1125476487 15:40051167-40051189 CACAGCCAACAGAGGAAGGAGGG + Intergenic
1126523684 15:49625645-49625667 CACACCGAACAAAGGAAGGAAGG + Intronic
1127013397 15:54655418-54655440 AAGAGGGAAGAAAGGAAGGAAGG + Intergenic
1128535554 15:68487301-68487323 CAGACAGAACCAAGGATGGAGGG - Intergenic
1130179279 15:81608702-81608724 GAGAGAGAACGAAGGAAGGAAGG - Intergenic
1130636261 15:85623513-85623535 CAGAACTAACAAAGGAAGCAGGG - Intronic
1131753831 15:95538977-95538999 CAGAAAGAAGAAAGGAAGGAAGG + Intergenic
1133666173 16:7970370-7970392 CAGAGGGAAGAAAGGAGGGAGGG - Intergenic
1133740380 16:8646830-8646852 CAGAGAGACCAAGGGGCGGAGGG - Exonic
1137826959 16:51506397-51506419 CAGTGTGAAGAAAGGATGGAAGG - Intergenic
1139495508 16:67314204-67314226 GAGAGAGAAGAAAGGAAGGAAGG - Intronic
1139734157 16:68973002-68973024 GAGAGAGAACAAAGGAAGGCGGG + Intronic
1140172912 16:72625964-72625986 CAGAAAGAAGAAAGGAAGGAAGG + Intergenic
1140575442 16:76162661-76162683 CAGAGAGAAGGAAGGAAGGAAGG - Intergenic
1140943978 16:79749969-79749991 CACAGTGGACAAAGGAAGGATGG - Intergenic
1141368550 16:83466299-83466321 CAGAGCCAGCAAAGGAGGCATGG + Intronic
1141680030 16:85538510-85538532 CAGAGAAAAGAAAGGACGCATGG - Intergenic
1141984549 16:87571320-87571342 CTGAGCAAATAAAGGAGGGAAGG - Intergenic
1142614006 17:1124702-1124724 CAGAGTGAACAGAGGAGGGCTGG + Intronic
1142753583 17:2002643-2002665 CAGAGAAAAGAAAGGAAGGAAGG - Intronic
1143259671 17:5588715-5588737 CACACTGAACAAAGGAGGGAAGG + Intronic
1143913544 17:10272092-10272114 AAGAGGGAAGAAAGGAAGGAAGG + Intergenic
1144072670 17:11688742-11688764 CAGAGTGATCAATGGAGGGAGGG + Intronic
1146249648 17:31327530-31327552 CAGAGCGAACAAAAGTCCTAGGG + Exonic
1147370983 17:39992826-39992848 CAGAGAGAACACTGGAGGGAAGG - Intronic
1147527055 17:41235764-41235786 CAGAGAGAAGGAAGGAAGGAAGG + Intronic
1147530172 17:41268987-41269009 AAGAGAGAAGAAAGGAAGGAAGG + Intergenic
1150440158 17:65184667-65184689 AAGAGAGAAAAAAGGAAGGAAGG - Intronic
1150459526 17:65336912-65336934 AAGAGAGAAGAAAGGAAGGAAGG - Intergenic
1150596533 17:66610699-66610721 CACACCGAACAAGGGAAGGAAGG + Intronic
1151656155 17:75496981-75497003 CAGAGGGAACAGGGGCCGGAGGG - Intronic
1151923424 17:77174856-77174878 CACACTGAACAAAGGAGGGAAGG + Intronic
1153078305 18:1191587-1191609 CACACCGAACAAAGGAGAGAAGG + Intergenic
1157013152 18:43677429-43677451 CAAAACGCACAAAGGAAGGATGG + Intergenic
1157126502 18:44961119-44961141 CAGAGGGAATGAAGGAAGGAGGG + Intronic
1158574414 18:58624079-58624101 CAGAGCCAACAAAGCAGGAAGGG - Intronic
1159550745 18:69894094-69894116 CAGAGTGAAAGAAGGAAGGAAGG + Intronic
1159602632 18:70443173-70443195 CACACCGAACAAAGGAAGGAAGG + Intergenic
1159804101 18:72934500-72934522 GAGAGAGAGCAAAGGAGGGAGGG - Intergenic
1160478850 18:79219684-79219706 TAAAGAGAAAAAAGGACGGAAGG - Intronic
1160763373 19:796784-796806 CGGGGCGAACAAAGAACGGTCGG + Intergenic
1161999804 19:7736670-7736692 GAGAGAGAAGAAAGGAAGGAAGG - Intergenic
1162490896 19:10990964-10990986 CAGGGCGAGCACAGGACAGAAGG - Intronic
1163240269 19:16058416-16058438 AAGAAAGAACAAAGGAAGGAAGG + Intergenic
1165655846 19:37531555-37531577 CAGTGGGAACAAAGGCCGGGGGG - Intronic
1167072475 19:47228703-47228725 CAGGGCTCACACAGGACGGATGG + Intronic
1168588773 19:57615590-57615612 CACACTGAACAAAGGAGGGAAGG + Intronic
925264892 2:2560176-2560198 CAGAGTGAATAAAGCACTGAGGG + Intergenic
927279154 2:21288478-21288500 CAGAGTGAACAAAGGGCTGTAGG + Intergenic
928173656 2:29020023-29020045 CACACCCAACAAAGGAGGGAAGG + Intronic
929447067 2:42010074-42010096 AAGAGAGAAGAAAGGAAGGAAGG + Intergenic
933555483 2:83825504-83825526 GAGAGAGAAGAAAGGAAGGAAGG + Intergenic
933971315 2:87472135-87472157 CAGAGGGAATAAAGGAGGGAGGG - Intergenic
934060505 2:88288198-88288220 GAGAGAGAAGAAAGGATGGAAGG - Intergenic
934550472 2:95258268-95258290 CACACCAAACAAAGGAGGGAAGG + Intronic
935430693 2:102972832-102972854 AAGAGCGAAGAAATGACTGAAGG + Intergenic
935713880 2:105922616-105922638 AAGAGAGAAAAAAGGACGCAAGG + Intergenic
935891173 2:107680206-107680228 GAGAGAGCACAAAGGATGGAGGG + Intergenic
936322415 2:111478064-111478086 CAGAGGGAATAAAGGAGGGAGGG + Intergenic
936607491 2:113972926-113972948 AAGAGCCAAAAAAGGAAGGAGGG + Intergenic
937089332 2:119195709-119195731 CAGAGGGAAGGAAGGAAGGAAGG + Intergenic
937169610 2:119852358-119852380 CACACTGAACAAAGGAAGGAAGG - Intronic
937683889 2:124674375-124674397 AAGAAAGAACAAAGGAGGGAGGG - Intronic
938341917 2:130541475-130541497 CTGAGCCAACACAGGAAGGAGGG + Intronic
938347915 2:130579236-130579258 CTGAGCCAACACAGGAAGGAGGG - Intronic
940372985 2:152923055-152923077 GAGAGGGAACGAAGGAAGGAAGG - Intergenic
943223804 2:185143897-185143919 GAGAGAGAACAAATGAGGGAAGG - Intergenic
943935902 2:193917236-193917258 AGGAGGGAACAAAGGAAGGAAGG - Intergenic
944484812 2:200194361-200194383 CACAGCGAACAAAGAATGGCTGG + Intergenic
944673074 2:202012257-202012279 CAGAAGGAAGAAAGGAAGGAAGG + Intergenic
945029536 2:205650551-205650573 AAGAGTGAAGCAAGGACGGAAGG - Intergenic
945032133 2:205675497-205675519 CAGAGCTAAAAAACGAAGGAAGG - Intergenic
945693976 2:213079501-213079523 GAGAGAGAAGAAAGGAAGGAAGG + Intronic
946124875 2:217553746-217553768 CAGAGAGAAGGAAGGAAGGAGGG - Intronic
946354180 2:219174703-219174725 GAGAGAGAACAAAGGACTAAAGG + Intronic
948268884 2:236658470-236658492 CAGAGAGAAAGAAGGAAGGAAGG - Intergenic
1169788635 20:9386240-9386262 GAGACCGAAGAAAGGAGGGAGGG + Intronic
1170640769 20:18150689-18150711 CAGAGCGAACAAAGGACGGACGG - Intronic
1170732053 20:18984338-18984360 CAGTGCGCACAAAGGCCAGAGGG - Intergenic
1171756380 20:29113721-29113743 GAGAGGGAAGAAAGGAGGGAAGG + Intergenic
1171862371 20:30412817-30412839 GAGAGGGAAGAAAGGAGGGAAGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172827046 20:37798008-37798030 CAGAGTGAACGCAGGAAGGAGGG - Intronic
1173201693 20:40959633-40959655 AAGAGGGAAGAAAGGAAGGAAGG + Intergenic
1173305193 20:41841225-41841247 CAGAGGGAGGGAAGGACGGAGGG - Intergenic
1173665041 20:44757261-44757283 CAGAGTGAGCAAAGGAAGGGTGG - Intronic
1173716560 20:45211937-45211959 AGGAGGGAACAAAGGAAGGAAGG + Intergenic
1173846499 20:46191930-46191952 CAGAGTGAAAGAAGGAGGGAGGG - Intronic
1175369488 20:58478367-58478389 CAGAGGGAAGGAAGGAAGGAAGG - Intronic
1178252507 21:31017750-31017772 CAGAGCAAACACAGGATGCAAGG + Intergenic
1178529937 21:33367572-33367594 CACACCGAACAAAGGAGAGAAGG - Intergenic
1179484336 21:41700106-41700128 GAGAGGGAAGAAAGGAGGGAGGG + Intergenic
1179782468 21:43710617-43710639 GAGAGAAAACAAAGGAAGGAAGG + Intergenic
1179838700 21:44055932-44055954 GGGAGGGAACAAAGGAGGGAAGG - Intronic
1180413427 22:12637546-12637568 GAGAGGGAAGAAAGGAAGGAGGG + Intergenic
1180413434 22:12637578-12637600 GAGAGGGAAGAAAGGAGGGAAGG + Intergenic
1181375270 22:22453131-22453153 CACACCAAACAAAGGAGGGAAGG - Intergenic
1181839221 22:25641380-25641402 GAGAGAGAACAAAGGAAGAAAGG - Intronic
1182964118 22:34505420-34505442 CTGAGAGAACAAAGGACTGATGG + Intergenic
1183007671 22:34916703-34916725 GAGAGGGAAGAAAGGAAGGAGGG + Intergenic
1183063219 22:35347858-35347880 CAGAAGGAACAGAGGAAGGATGG - Exonic
1183917695 22:41136035-41136057 CAGAGCGAAAAAAGAAAGAATGG - Intronic
949681435 3:6519106-6519128 CACACTGAACAAAGGAGGGAAGG - Intergenic
951832753 3:26949008-26949030 CAAAGAGAAGAAAGGATGGATGG + Intergenic
953438220 3:42896695-42896717 AAGAGAGAACAAAGGAGAGAAGG - Intronic
954462789 3:50637213-50637235 CCGAGCAAACAAAGGATGGGAGG - Intronic
954784217 3:53081286-53081308 CTGAGCCAGCAAAGGAGGGAGGG - Intronic
955393385 3:58537126-58537148 CAGTGCGGACACAGGACAGAGGG - Exonic
956327266 3:68067746-68067768 AAGAGGGAAGAAAGGAAGGAAGG - Intronic
956737725 3:72251220-72251242 CACAAGGAACAAAGGAAGGATGG + Intergenic
957988963 3:87607240-87607262 CACACCGAACAAAGGAGGGAAGG + Intergenic
958137828 3:89519279-89519301 GAGAGGGAAGAAAGGAAGGAAGG - Intergenic
959155487 3:102662037-102662059 CAGAGCGAACAAAGGTTTGGAGG + Intergenic
960659862 3:120045616-120045638 CACAGGGAACAAAGGAGAGAAGG - Intronic
960707684 3:120496025-120496047 CACACCAAACAAAGGAGGGAAGG - Intergenic
963108571 3:141666117-141666139 CGGAGAGTAGAAAGGACGGAAGG + Intergenic
967605359 3:191438541-191438563 AAGAGAGAAGAAAGGAAGGAAGG - Intergenic
967782109 3:193451094-193451116 CAGAGCCAGCAAAGGAGGCATGG - Intronic
969371486 4:6734110-6734132 TCCAGCGAGCAAAGGACGGAAGG + Intergenic
972698164 4:41468250-41468272 CAGAAGGAAGAAAGGAGGGAGGG - Intronic
973544409 4:51966251-51966273 GAGAGGGAAGAAAGGAAGGAAGG - Intergenic
973779079 4:54271678-54271700 AAGAGAGAACAAAGGAGGGAGGG - Intronic
973977141 4:56273375-56273397 GAGAGGGAAGAAAGGAGGGAGGG - Intronic
974586696 4:63889006-63889028 CAAAGGGAAAAAAGGAAGGAAGG - Intergenic
975240012 4:72046407-72046429 CAGAGAGAACAAAAGGCGGCTGG - Intronic
977551818 4:98450665-98450687 CAGAGGGTACATAGGAAGGAAGG + Intergenic
977870155 4:102081577-102081599 CAGAGGGAAGGAAGGAAGGAAGG + Intergenic
979101083 4:116615410-116615432 ATGAGGGAACAAAGGAAGGAAGG + Intergenic
979425651 4:120561967-120561989 CACACCAAACAAAGGAGGGAAGG - Intergenic
982007789 4:151079846-151079868 GAGAGAGAAGAAAGGAAGGAAGG - Intergenic
983973187 4:173899641-173899663 GAGAGGGAAGAAAGGAAGGAAGG - Intergenic
985137505 4:186801972-186801994 CACACCGAACAAAGGAAGGAAGG + Intergenic
985273609 4:188216839-188216861 TAGAGCAAAGAAAGGAGGGAGGG - Intergenic
985446549 4:190023890-190023912 TGGAGCGAGAAAAGGACGGATGG - Intergenic
987898246 5:23977547-23977569 CATACCGAACAAAGGAGGGAAGG - Intronic
989605160 5:43237218-43237240 CAGAGAGAACAAAGGTGAGATGG + Intronic
990777646 5:59321101-59321123 CAGACTGAACAAAGTACAGATGG - Intronic
990986820 5:61648467-61648489 CAGAGTGAACAAAGGAAAGTAGG + Intronic
991557789 5:67914922-67914944 CAGAGCTAACATAGGAATGATGG - Intergenic
992865886 5:80956837-80956859 AAGAGGAAAGAAAGGACGGAAGG - Intergenic
993256807 5:85601799-85601821 AAGAAGGAACAAAGGAAGGAAGG - Intergenic
998787234 5:145726207-145726229 AAGAGAGAAGAAAGGAAGGAAGG + Intronic
999668943 5:153941422-153941444 CACACCAAACAAAGGAGGGAAGG - Intergenic
1000576574 5:162982411-162982433 CAGAAAGAACAAAGGAAGAAAGG + Intergenic
1002910076 6:1483395-1483417 GAGAGAGAAGAAAGGAAGGAAGG + Intergenic
1003009815 6:2416184-2416206 AAGAGAGAAAAAAGGAAGGAAGG - Intergenic
1003140293 6:3465747-3465769 ATGAACGAACAAAGGAAGGATGG + Intergenic
1005602564 6:27442705-27442727 GAGAGAGAAAGAAGGACGGAAGG + Intergenic
1006033846 6:31197038-31197060 CAGAGTGGAGAAAGGAGGGAAGG - Intergenic
1007837193 6:44682683-44682705 CAGAGAGAGGAAAGGAGGGAAGG - Intergenic
1008428578 6:51388086-51388108 CAGAGCAAACAAAGGGATGAAGG + Intergenic
1009628019 6:66161766-66161788 CACACTGAACAAAGGAGGGAAGG + Intergenic
1009629374 6:66173830-66173852 CACACCAAACAAAGGAGGGAAGG + Intergenic
1009745738 6:67812942-67812964 CACACTGAACAAAGGAGGGAAGG + Intergenic
1012373670 6:98535667-98535689 CACAGAGAAAAAAGGAAGGAAGG + Intergenic
1012545326 6:100412779-100412801 AAGAGAGAACGAAGGAAGGAAGG + Intronic
1014942293 6:127456910-127456932 GGGAGGGAACAAAGGACAGAAGG - Intronic
1016674371 6:146747020-146747042 CAGAGAGAACAAAGGACTATAGG - Intronic
1016732117 6:147438434-147438456 CAGAACCAACAAAGGATGCAAGG + Intergenic
1018080055 6:160251514-160251536 CAGAAGGAAAAAAGGAAGGAAGG - Intronic
1020391721 7:7665671-7665693 CAGAGGGAACAAAGGAAGGAGGG - Intronic
1021049987 7:15971293-15971315 ATGAGCGAAAAAAGGAAGGAAGG + Intergenic
1021108137 7:16662764-16662786 GAGAGAGAAAAAAGGAAGGAAGG + Intronic
1023178650 7:37458585-37458607 CTGAGCAAACAAAGGAAGAAAGG - Intergenic
1023565735 7:41522140-41522162 AAGAGGGAAGAAAGGAAGGAAGG + Intergenic
1023737494 7:43247935-43247957 GAGAGAGAAAAAAGGAGGGAAGG + Intronic
1023761114 7:43466018-43466040 CAGAGGGAAGGAAGGAAGGAAGG + Intronic
1024951073 7:54860846-54860868 CAGAGAGAACAGAGGAAGGGAGG + Intergenic
1025736076 7:64148003-64148025 GAGAGAGAAGAAAGGAAGGAAGG - Intronic
1026766098 7:73160801-73160823 CAGAAAGAACAAAGGCCTGAAGG - Intergenic
1027042573 7:74970497-74970519 CAGAAAGAACAAAGGCCTGAAGG - Intronic
1027081070 7:75231860-75231882 CAGAAAGAACAAAGGCCTGAAGG + Intergenic
1028017847 7:85737706-85737728 CACACTGAACAAAGGAGGGAAGG + Intergenic
1029141612 7:98414793-98414815 GAGAGAGAAAAAAGGAAGGAAGG + Intergenic
1030495272 7:110290879-110290901 CAGAAAGAATAAAGGAGGGAAGG - Intergenic
1030525090 7:110643083-110643105 TAGAGGGAAGAAAGGAAGGAAGG + Intergenic
1031526877 7:122833101-122833123 CAGACAGAACAAAGGCTGGAAGG - Intronic
1033883710 7:145918161-145918183 AAGAAGGAACAAAGGAAGGAAGG + Intergenic
1034233375 7:149549874-149549896 GAGAGCTGAAAAAGGACGGAGGG - Intergenic
1036126570 8:6068489-6068511 CAGAGGGAATGAAGGAGGGAAGG - Intergenic
1036191975 8:6678793-6678815 GAAAGAGAACAAAGGAAGGAAGG + Intergenic
1036546071 8:9771229-9771251 GAGAGCGAGGAAAGGAGGGAGGG + Intronic
1036789718 8:11709462-11709484 CACCGAGAACAAAGGAGGGATGG + Intronic
1037126594 8:15358780-15358802 CAGAGGGAAGGAAGGAAGGAAGG - Intergenic
1037656152 8:20885953-20885975 CAGAGAGAAGAAAAGAAGGATGG + Intergenic
1039900026 8:41745111-41745133 CAGAGAGAGGAAAGGATGGAGGG + Intronic
1040629290 8:49191107-49191129 AAGAAAGAACAAAGGAAGGAAGG - Intergenic
1040974748 8:53177551-53177573 CACACCGAACAAACGAGGGAAGG - Intergenic
1041155747 8:54985245-54985267 CAGAAGGAAGAAAGGAAGGAAGG + Intergenic
1043331133 8:79120174-79120196 CACACCGAACAAAGGAGGGAAGG - Intergenic
1043331703 8:79124513-79124535 CACACCGAACAAAGGAGGGAAGG - Intergenic
1045087420 8:98701247-98701269 AAGAGGGAAGGAAGGACGGAAGG + Intronic
1045615656 8:103907515-103907537 CAGAGAAAAAAAAGGAAGGAAGG - Intronic
1045628164 8:104082168-104082190 AAGAAGGAATAAAGGACGGAAGG + Intronic
1047490812 8:125373350-125373372 CAGAGAGAACAAGGGAGGGGAGG - Intergenic
1048363126 8:133715200-133715222 AAGAGGGAAGAAAGGAAGGAAGG - Intergenic
1049299079 8:141860338-141860360 CAGAGCCAACAAATGGCAGAGGG - Intergenic
1050701327 9:8342941-8342963 TAGTATGAACAAAGGACGGATGG + Intronic
1051090327 9:13399773-13399795 AAGAGAGAAAAAAGGAAGGAAGG + Intergenic
1052638712 9:31136255-31136277 GAGAGAGAAGAAAGGAAGGAAGG + Intergenic
1055783607 9:79847312-79847334 CAGAGAGAACAAAGGGCAAAGGG - Intergenic
1058935821 9:109768198-109768220 CAGGGAGAAAAAAGGAAGGAAGG + Intronic
1059712012 9:116877208-116877230 CACACCTAACAAAGGAGGGAAGG - Intronic
1061829020 9:133278822-133278844 CACACTGAACAAAGGAGGGAAGG + Intergenic
1202802113 9_KI270720v1_random:9572-9594 GAGAGGGAAGAAAGGAGGGAAGG - Intergenic
1202802121 9_KI270720v1_random:9602-9624 GAGAGGGAAGAAAGGAAGGAGGG - Intergenic
1185734296 X:2485610-2485632 CAGAGGGAAGGAAGGAGGGAGGG + Intronic
1189178708 X:38982955-38982977 GAGAGTGAGCAAAGGAAGGAGGG + Intergenic
1190620288 X:52280785-52280807 CACACTGAACAAAGGAGGGAAGG + Intergenic
1191233682 X:58117361-58117383 CACACCGAACAAAGGAGGGAAGG - Intergenic
1192744305 X:73923628-73923650 CAGAGTGCACAAAGAAGGGAGGG - Intergenic
1192939024 X:75893369-75893391 CCTAGAGAACAAAGGAAGGAGGG - Intergenic
1194329752 X:92567340-92567362 TACAGCTAACAAAGGAAGGAAGG - Intronic
1200638454 Y:5686522-5686544 TACAGCTAACAAAGGAAGGAAGG - Intronic
1201454968 Y:14159806-14159828 CAAAGAGAACCAAGGAAGGATGG - Intergenic
1202273679 Y:23094772-23094794 AGGAGGGAACAAAGGAAGGAAGG + Intergenic
1202292348 Y:23325909-23325931 AGGAGGGAACAAAGGAAGGAAGG - Intergenic
1202426675 Y:24728517-24728539 AGGAGGGAACAAAGGAAGGAAGG + Intergenic
1202444114 Y:24941569-24941591 AGGAGGGAACAAAGGAAGGAAGG - Intergenic