ID: 1170644253

View in Genome Browser
Species Human (GRCh38)
Location 20:18182656-18182678
Sequence CAGGGTGATCATGGAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 493}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170644253_1170644260 5 Left 1170644253 20:18182656-18182678 CCTGCAGCTCCATGATCACCCTG 0: 1
1: 0
2: 2
3: 23
4: 493
Right 1170644260 20:18182684-18182706 CCATGCCAGCACCACATTCCTGG No data
1170644253_1170644261 6 Left 1170644253 20:18182656-18182678 CCTGCAGCTCCATGATCACCCTG 0: 1
1: 0
2: 2
3: 23
4: 493
Right 1170644261 20:18182685-18182707 CATGCCAGCACCACATTCCTGGG 0: 1
1: 0
2: 2
3: 23
4: 209
1170644253_1170644263 10 Left 1170644253 20:18182656-18182678 CCTGCAGCTCCATGATCACCCTG 0: 1
1: 0
2: 2
3: 23
4: 493
Right 1170644263 20:18182689-18182711 CCAGCACCACATTCCTGGGCAGG 0: 1
1: 0
2: 1
3: 32
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170644253 Original CRISPR CAGGGTGATCATGGAGCTGC AGG (reversed) Intronic
900072741 1:786415-786437 CAGGGTGATCCTTGATCTCCTGG + Intergenic
900265407 1:1754639-1754661 CAGGGTGGTGAAGGAGCTCCGGG - Exonic
900694137 1:3999752-3999774 CAGGGTGGGCATGGAGTTGCAGG + Intergenic
900898069 1:5497679-5497701 CAGCCTGACCCTGGAGCTGCGGG - Intergenic
901258251 1:7850622-7850644 CAGTGCGAGCAAGGAGCTGCTGG + Intronic
902459820 1:16565786-16565808 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
902460004 1:16567332-16567354 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
902676957 1:18015442-18015464 CAGGGGGATCTTGGAGCTTGGGG + Intergenic
903153195 1:21427937-21427959 CAGGCTCAGCAGGGAGCTGCTGG - Intergenic
903159939 1:21480048-21480070 CAGGCTCAGCAGGGAGCTGCTGG + Exonic
904349519 1:29895842-29895864 CCGCGTGGTCATGGAGCTGGAGG + Intergenic
904497011 1:30892759-30892781 GAGGGTGACCATGGTGCTACAGG - Intronic
904537175 1:31207575-31207597 CAGGGGGGTCAGGCAGCTGCTGG - Intronic
904597402 1:31655483-31655505 TAGGGTGATCCAGGAGCTGCAGG - Exonic
905819925 1:40980890-40980912 CAGGGTGAACAGGCAGGTGCAGG - Intronic
907922616 1:58927844-58927866 CCAGGTGATCATTGAGCAGCTGG - Intergenic
909635720 1:77814814-77814836 TTGGGTGATAATGAAGCTGCTGG + Intronic
910006264 1:82400856-82400878 CAGGATGATCATGCAGCCTCGGG + Intergenic
910214807 1:84832541-84832563 CAGGGTCATGAAGGAGTTGCAGG + Intronic
910315185 1:85874683-85874705 CAGGGAGATGTTGGAACTGCTGG - Exonic
911857523 1:102898975-102898997 TAGGGTCCTCCTGGAGCTGCAGG - Exonic
912078930 1:105911778-105911800 CAGGGTGGTCCTGGAGGGGCAGG - Intergenic
912171282 1:107102653-107102675 CTGGCTGATCATGTAGCTCCTGG + Intergenic
913467740 1:119159523-119159545 CAGGGTGCTGAGGGAGCTCCAGG - Intergenic
913605407 1:120461251-120461273 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
913605585 1:120462791-120462813 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
913605768 1:120464373-120464395 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
913611361 1:120512674-120512696 CAGGCTCAGCAGGGAGCTGCAGG - Intergenic
913643001 1:120830413-120830435 CAGGCTCAGCAGGGAGCTGCTGG + Exonic
913643186 1:120831985-120832007 CAGGCTCAGCAGGGAGCTGCTGG + Exonic
913643363 1:120833600-120833622 CAGGCTCAGCAGGGAGCTGCTGG + Intronic
913643487 1:120834627-120834649 CAGGCTCAGCAGGGAGCTGCTGG + Intronic
913643768 1:120837166-120837188 CAGGCTCAGCAGGGAGCTGCTGG + Intronic
913643953 1:120838742-120838764 CAGGCTCAGCAGGGAGCTGCTGG + Intronic
913983430 1:143544148-143544170 CAGGCTCAGCAGGGAGCTGCAGG + Intergenic
913989759 1:143600029-143600051 CAGGCTCAGCAGGGAGCTGCTGG - Intergenic
914082781 1:144424843-144424865 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914082959 1:144426431-144426453 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914083131 1:144427971-144427993 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914177695 1:145293357-145293379 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914177877 1:145294935-145294957 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914178057 1:145296491-145296513 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914178240 1:145298115-145298137 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914178422 1:145299701-145299723 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914178602 1:145301253-145301275 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914178785 1:145302877-145302899 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914178967 1:145304447-145304469 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914179163 1:145306046-145306068 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914179345 1:145307630-145307652 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914179539 1:145309229-145309251 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914179720 1:145310811-145310833 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914179899 1:145312361-145312383 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914180083 1:145313985-145314007 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914180265 1:145315579-145315601 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914180445 1:145317131-145317153 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914180628 1:145318757-145318779 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914180810 1:145320349-145320371 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914180988 1:145321893-145321915 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914181171 1:145323519-145323541 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914181353 1:145325099-145325121 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914181531 1:145326643-145326665 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914181714 1:145328267-145328289 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914181896 1:145329859-145329881 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914182076 1:145331410-145331432 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914182259 1:145333034-145333056 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914182441 1:145334612-145334634 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914182621 1:145336166-145336188 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914182804 1:145337790-145337812 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914182986 1:145339368-145339390 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914183166 1:145340920-145340942 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914183349 1:145342540-145342562 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914183531 1:145344122-145344144 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914183711 1:145345674-145345696 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914183893 1:145347298-145347320 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914184074 1:145348892-145348914 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914184254 1:145350444-145350466 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914184437 1:145352070-145352092 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914184618 1:145353656-145353678 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914184798 1:145355208-145355230 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914184981 1:145356832-145356854 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914185163 1:145358404-145358426 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914185343 1:145359955-145359977 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914185526 1:145361579-145361601 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914185708 1:145363157-145363179 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914185888 1:145364709-145364731 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914186072 1:145366333-145366355 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914186254 1:145367917-145367939 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914186435 1:145369469-145369491 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914186618 1:145371093-145371115 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914186799 1:145372665-145372687 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914186979 1:145374217-145374239 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914187162 1:145375841-145375863 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914187344 1:145377419-145377441 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914187522 1:145378967-145378989 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914187705 1:145380593-145380615 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914187887 1:145382171-145382193 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914188067 1:145383723-145383745 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914188250 1:145385347-145385369 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914188432 1:145386927-145386949 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914188610 1:145388471-145388493 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914188793 1:145390097-145390119 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914188975 1:145391683-145391705 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914189152 1:145393227-145393249 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914210653 1:145575800-145575822 CAGGCTCAGCAGGGAGCTGCTGG - Intergenic
914210830 1:145577374-145577396 CAGGCTCAGCAGGGAGCTGCTGG - Intergenic
914211003 1:145578936-145578958 CAGGCTCAGCAGGGAGCTGCTGG - Intergenic
914269591 1:146068156-146068178 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914269766 1:146069696-146069718 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914269945 1:146071300-146071322 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914270128 1:146072882-146072904 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914270306 1:146074424-146074446 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914270486 1:146076022-146076044 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914270667 1:146077620-146077642 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914270843 1:146079160-146079182 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914271022 1:146080758-146080780 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914271205 1:146082350-146082372 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914271380 1:146083890-146083912 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914271560 1:146085494-146085516 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914271740 1:146087077-146087099 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914271915 1:146088617-146088639 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914272095 1:146090215-146090237 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914272276 1:146091795-146091817 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914272452 1:146093335-146093357 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914272631 1:146094933-146094955 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914272814 1:146096517-146096539 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914272990 1:146098057-146098079 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914273169 1:146099655-146099677 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914273352 1:146101239-146101261 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914273528 1:146102779-146102801 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914273708 1:146104377-146104399 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914273891 1:146105957-146105979 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914274067 1:146107497-146107519 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914274246 1:146109095-146109117 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914274427 1:146110665-146110687 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914274604 1:146112207-146112229 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914274782 1:146113805-146113827 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914274962 1:146115383-146115405 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914275137 1:146116925-146116947 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914275316 1:146118523-146118545 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914275498 1:146120109-146120131 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914275674 1:146121651-146121673 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914275851 1:146123259-146123281 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914276034 1:146124841-146124863 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914366617 1:146984810-146984832 CAGGCTCAGCAGGGAGCTGCTGG + Exonic
914366793 1:146986349-146986371 CAGGCTCAGCAGGGAGCTGCTGG + Exonic
914366978 1:146987951-146987973 CAGGCTCAGCAGGGAGCTGCTGG + Exonic
914367150 1:146989571-146989593 CAGGCTCAGCAGGGAGCTGCTGG + Exonic
914367329 1:146991110-146991132 CAGGCTCAGCAGGGAGCTGCTGG + Exonic
914367514 1:146992709-146992731 CAGGCTCAGCAGGGAGCTGCTGG + Exonic
914485471 1:148105509-148105531 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914485653 1:148107095-148107117 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914485828 1:148108635-148108657 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914532425 1:148534837-148534859 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914532603 1:148536377-148536399 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914532966 1:148539563-148539585 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914533138 1:148541103-148541125 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914533318 1:148542707-148542729 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914533501 1:148544277-148544299 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914533673 1:148545817-148545839 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914533853 1:148547421-148547443 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914534036 1:148548985-148549007 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914534209 1:148550525-148550547 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914534389 1:148552129-148552151 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914534571 1:148553693-148553715 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914534745 1:148555233-148555255 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914534925 1:148556843-148556865 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914535106 1:148558405-148558427 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914535460 1:148561560-148561582 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914535642 1:148563150-148563172 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914535817 1:148564692-148564714 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914535997 1:148566296-148566318 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914536177 1:148567866-148567888 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914536353 1:148569408-148569430 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914536531 1:148571018-148571040 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914536712 1:148572596-148572618 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914536892 1:148574206-148574228 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914537073 1:148575792-148575814 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914537249 1:148577336-148577358 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914579831 1:149009565-149009587 CAGGCTCAGCAGGGAGCTGCAGG + Exonic
914585437 1:149057488-149057510 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914585618 1:149059078-149059100 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914585803 1:149060676-149060698 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914585984 1:149062246-149062268 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914586163 1:149063786-149063808 CAGGCTCAGCAGGGAGCTGCTGG - Exonic
914628675 1:149488010-149488032 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914628850 1:149489558-149489580 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914629208 1:149492765-149492787 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914629384 1:149494315-149494337 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914629741 1:149497522-149497544 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914629918 1:149499070-149499092 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914630276 1:149502283-149502305 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914630452 1:149503831-149503853 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914630810 1:149507044-149507066 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914630986 1:149508592-149508614 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914631341 1:149511805-149511827 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914631517 1:149513353-149513375 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914631696 1:149514933-149514955 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914631873 1:149516561-149516583 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914632051 1:149518107-149518129 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914632232 1:149519685-149519707 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914632409 1:149521316-149521338 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914632588 1:149522862-149522884 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914632769 1:149524442-149524464 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914632944 1:149526067-149526089 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914633123 1:149527611-149527633 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914633303 1:149529171-149529193 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914633479 1:149530796-149530818 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914633658 1:149532342-149532364 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914633839 1:149533922-149533944 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914634015 1:149535551-149535573 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914634194 1:149537097-149537119 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914634375 1:149538673-149538695 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914634548 1:149540298-149540320 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914634727 1:149541850-149541872 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914634908 1:149543410-149543432 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914635083 1:149545035-149545057 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914635262 1:149546587-149546609 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914635443 1:149548147-149548169 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914635618 1:149549772-149549794 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914635797 1:149551324-149551346 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
914635978 1:149552884-149552906 CAGGCTCAGCAGGGAGCTGCTGG + Intergenic
915016976 1:152743555-152743577 CAGGGAGATCCTGGAGCCTCAGG + Intronic
915515543 1:156410365-156410387 CAGGGTGCTCATTGTGCTGAGGG + Intronic
917401820 1:174658074-174658096 CAAGGTTATCATGGAGCTGGAGG + Intronic
918407084 1:184222211-184222233 CAGGGCGACCATGGAACTGTTGG + Intergenic
919625713 1:199908163-199908185 CAAGGGGTTCATGGAGCTGCAGG - Intergenic
919811447 1:201411395-201411417 CAAGGTGTCCATGGATCTGCGGG - Exonic
919896432 1:202012366-202012388 CAGTTGGATCATTGAGCTGCTGG + Exonic
921680999 1:218030845-218030867 CAGGGGCTTCATGGAGCTGCAGG + Intergenic
922193292 1:223338701-223338723 CAGGCTGCGCATGCAGCTGCAGG + Intronic
922268329 1:224009342-224009364 CAGGGTGATCCTTGATCTCCTGG + Intergenic
922572409 1:226641945-226641967 CAGGGTGGCCGTGGAGCTGATGG + Exonic
922674162 1:227540911-227540933 CAGGCTGTACCTGGAGCTGCAGG + Intergenic
922902594 1:229148279-229148301 CAGGGTGGTCATGGCCCTGTGGG - Intergenic
1062891388 10:1063373-1063395 CAGGGTGAGGGTGGTGCTGCAGG - Intronic
1062891400 10:1063454-1063476 CAGGGTGAGGGTGGTGCTGCAGG - Intronic
1062998805 10:1894196-1894218 AAGGGAGGTCATGGAGCTGGAGG + Intergenic
1064064193 10:12166716-12166738 CTGGAAAATCATGGAGCTGCTGG + Exonic
1064451308 10:15444641-15444663 CAGGGAGATCACAGAGCTGAAGG + Intergenic
1065098206 10:22303785-22303807 CAGGCTGATCTTGGAACTCCTGG - Intergenic
1065804734 10:29384073-29384095 CAGGGTGATCAGAGAGCAGGAGG + Intergenic
1067469921 10:46528629-46528651 CAGGGTCACCCTGCAGCTGCAGG - Intergenic
1067717274 10:48699193-48699215 CAGGGTGACCATGGAGAAGAGGG + Intronic
1069333257 10:67318579-67318601 CAGAGTGAACATGGAGATGAAGG - Intronic
1069544637 10:69319368-69319390 AGGTGTGATCATGGAGATGCTGG + Intronic
1069635947 10:69924960-69924982 CAGGGGGAGCGTGGAGCAGCTGG + Exonic
1069956271 10:72053837-72053859 CAGGGTGATCCTGGGGGTCCTGG + Intergenic
1073262817 10:102203463-102203485 CAGGGAGATCAAGGGGCAGCAGG - Intergenic
1074057300 10:109934047-109934069 CAGGGTGAGCAGGAAGCTGTGGG + Intergenic
1075155682 10:119974339-119974361 CATTGTGATCGTGGAGATGCTGG + Intergenic
1075744219 10:124715393-124715415 CAGGGTGCTCCTGGGCCTGCAGG + Intronic
1077353812 11:2105507-2105529 CAGGGTGCTCCTGGGGCAGCAGG - Intergenic
1077864616 11:6211879-6211901 CAGGGGTATCATGAAGGTGCTGG + Intronic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1079201855 11:18383479-18383501 CATGGTTACCATGGAGATGCTGG + Intergenic
1079260285 11:18871979-18872001 CAGCGAGATCATGGTGGTGCTGG - Intergenic
1081110671 11:39129733-39129755 CAGGGTGATCAGTCAGCTGGTGG + Intergenic
1081409111 11:42734876-42734898 CAGGGACATGATGGAGCTGGAGG + Intergenic
1083341678 11:61962339-61962361 GATGGTGATCATGGGACTGCAGG - Exonic
1083367188 11:62148464-62148486 CTGGGTCCTCAGGGAGCTGCAGG + Exonic
1084945511 11:72636181-72636203 CAGGAAGGTCCTGGAGCTGCAGG + Intronic
1090428887 11:126629564-126629586 CAGGGTGGACATGGATCTGGAGG - Intronic
1090638762 11:128712340-128712362 CATGGTGCTCATGGTTCTGCAGG - Intronic
1091569525 12:1672452-1672474 CAGGGTGAACATTGAGCCCCAGG - Intergenic
1092627332 12:10340750-10340772 CAGGGACATGATGGAGCTGGAGG - Intergenic
1095981719 12:47978080-47978102 CAGGGTGCTCCTGGAGCATCTGG - Exonic
1101749829 12:107574393-107574415 CCAGGTGATAATGCAGCTGCTGG - Intronic
1102033742 12:109759385-109759407 CAGAGGGACCATGGAGCAGCGGG - Intronic
1102208578 12:111107482-111107504 CAGGGAGTTCCGGGAGCTGCAGG + Intronic
1102297290 12:111747072-111747094 CACGGGCAACATGGAGCTGCTGG + Exonic
1104815553 12:131643684-131643706 CAGGGTCCTCATGGAGTTGTGGG - Intergenic
1104903219 12:132200152-132200174 CAGGGTGGACCAGGAGCTGCAGG + Intronic
1105259782 13:18770550-18770572 AAGGGTGATTTTGGAGCTGTAGG - Intergenic
1105262462 13:18789873-18789895 AAGGGTGATTTTGGAGCTGTAGG - Intergenic
1106234798 13:27852735-27852757 CAAGGTGATGCTGGTGCTGCTGG + Intergenic
1106351462 13:28934937-28934959 CAGGGGTACCAGGGAGCTGCTGG - Intronic
1107017530 13:35719669-35719691 CAGGGTGATGTTGTAACTGCAGG - Intergenic
1107665400 13:42683920-42683942 CAGTGTGATCATGGAGCTGAAGG + Intergenic
1111623836 13:90757685-90757707 CCGGGTGATTCTGAAGCTGCTGG + Intergenic
1112128626 13:96497318-96497340 CGGGGTGATCATGAGTCTGCAGG - Intronic
1113064586 13:106360308-106360330 CAGCCTGGTCCTGGAGCTGCAGG + Intergenic
1113530110 13:111018283-111018305 CATGGGGAGCGTGGAGCTGCTGG - Intergenic
1113812097 13:113149228-113149250 CTGGGTGATGATGAAGCTGCTGG - Exonic
1116222863 14:42111372-42111394 CACGGAGATCATGGAGCAGTGGG - Intergenic
1118718835 14:68579679-68579701 CAGGCTGATTTGGGAGCTGCCGG - Intronic
1119158242 14:72431232-72431254 CAGGGTGATTTTGGAGCAGGTGG - Intronic
1121511975 14:94519352-94519374 TATGGTGATGATGGAGCTGGAGG + Intergenic
1123127083 14:105954353-105954375 CAGGGTGCACATGCATCTGCTGG - Intergenic
1128709049 15:69858309-69858331 CAGGCTGGTCCTGGAGCTCCTGG + Intergenic
1129755327 15:78094587-78094609 CAGGGTGCTGGGGGAGCTGCAGG + Intronic
1130518623 15:84645374-84645396 CAGGTTTATCATGGTGCTGGAGG + Intronic
1132317501 15:100900645-100900667 CAGGGTGTTCGTGGAGGAGCAGG + Exonic
1132468881 16:90691-90713 GAGGGTCAACAAGGAGCTGCTGG + Intronic
1132568486 16:633994-634016 CAAGAAGATCTTGGAGCTGCTGG + Exonic
1134540177 16:15057618-15057640 CAGGGTGATCAATGACCAGCAGG + Intronic
1135044046 16:19140183-19140205 CAGGATGATCAGAGAGCTGGGGG - Intronic
1135803744 16:25523302-25523324 CAAGGTGGCCATGGGGCTGCTGG - Intergenic
1135941098 16:26822559-26822581 CAGGGTGACCCTGAGGCTGCAGG + Intergenic
1137316874 16:47334687-47334709 CAGGGTGGGGAAGGAGCTGCAGG - Intronic
1137604640 16:49779416-49779438 CAGGGTGATGTTGATGCTGCTGG - Intronic
1138383198 16:56617815-56617837 CTGGTTGATCAGGGGGCTGCTGG + Intergenic
1139365745 16:66432517-66432539 CAGGGGTTTCATGGATCTGCGGG - Intronic
1140288008 16:73622749-73622771 CAGGGTGCCCTTAGAGCTGCTGG - Intergenic
1140525403 16:75618732-75618754 CAGGATGGTCATGTAGCTCCTGG + Intronic
1140798639 16:78464387-78464409 CAGGGAGATAATGGAGATCCTGG + Intronic
1140941107 16:79722758-79722780 CATGGTGATGATGGTGCTGGTGG + Intergenic
1141442179 16:84036708-84036730 CAGGGTGATCGGGGACCAGCTGG - Exonic
1141544208 16:84753189-84753211 CAGGCTGATCTTGGAACTCCTGG + Intronic
1142359286 16:89619110-89619132 CAGGGGGGGCAGGGAGCTGCAGG - Intronic
1142359495 16:89619573-89619595 CAGGGGGACCAGGGGGCTGCAGG - Intronic
1142428022 16:90011102-90011124 CAGGGTCCTCAGGGTGCTGCTGG - Intronic
1142471595 17:166143-166165 CAGGGTGCTCAGGGAACTGCCGG - Intronic
1143107413 17:4536585-4536607 CAGGGTCAGCCTGGAGCTGTGGG + Intronic
1143166518 17:4899773-4899795 CAGGGTGTCCAGGGAGCTGGGGG - Exonic
1144068360 17:11644374-11644396 GAGGGTGCTGGTGGAGCTGCGGG + Intronic
1145262000 17:21360072-21360094 CAGGGTCATCATGGGGCAGCAGG - Intergenic
1147987650 17:44315580-44315602 AGGCGTGATCCTGGAGCTGCAGG + Exonic
1148778534 17:50109224-50109246 CAGGGGCCTCCTGGAGCTGCAGG - Intronic
1148795555 17:50195081-50195103 CAGGGTGAACCTGGTGCTCCTGG - Exonic
1149850032 17:60028681-60028703 CAGGGTGCTCAGGGGCCTGCCGG + Intergenic
1149860135 17:60117843-60117865 CAGGGTGCTCAGGGGCCTGCCGG - Intergenic
1151613018 17:75189063-75189085 CAGGCTGATCTTGGAACTCCTGG - Intergenic
1151728946 17:75899730-75899752 TAGGGTGTGCATGGAGCTGAGGG - Intronic
1152407823 17:80107676-80107698 CAGGGTGATCCTGGTCCAGCTGG - Intergenic
1152474530 17:80509315-80509337 CAGGTTGATGGTGGAGGTGCAGG + Intergenic
1152743846 17:82030360-82030382 CAGGGTGCGCGTGGAGCTGCAGG + Exonic
1153443826 18:5150619-5150641 CTGGGTGATCATAGAGAAGCAGG - Intronic
1153554508 18:6296925-6296947 CAGGTTGATGATGGTGCTACAGG + Intronic
1154095512 18:11410944-11410966 CATGGTGAAGATGGTGCTGCAGG + Intergenic
1157445477 18:47743455-47743477 GAGCAGGATCATGGAGCTGCAGG + Intergenic
1157499322 18:48178929-48178951 AAGGGTGGCCATGGAGCAGCAGG + Intronic
1158306336 18:56110097-56110119 CAGGGTTCTCATGGAGCTTGGGG + Intergenic
1160557142 18:79733376-79733398 CTGTGTGATCATGGAACTGCGGG + Intronic
1160583229 18:79899503-79899525 CACGGTGGTCATGGAGATGACGG - Exonic
1161156201 19:2732970-2732992 CAGGGGGATCATGGCGCTTACGG + Exonic
1162321607 19:9973953-9973975 CAGGGTCCCCATGGAGCTCCAGG - Exonic
1162583598 19:11545615-11545637 CAGGGAGATGAGGGAGTTGCTGG + Intronic
1162831084 19:13285082-13285104 CAGGATGAACATGGAGCTATAGG + Exonic
1162917477 19:13882116-13882138 CTGGGCGATCATCCAGCTGCAGG - Intergenic
1163237791 19:16039412-16039434 CAGGGTGGTCCTGGGGATGCAGG + Intergenic
1163790777 19:19305034-19305056 CAGGGTACCCTTGGAGCTGCTGG + Intronic
1164646434 19:29861892-29861914 CAGTGTAAGCCTGGAGCTGCTGG - Intergenic
1164828178 19:31299554-31299576 CAGGGTGTTCATGGACTTTCAGG - Intronic
1165406166 19:35632672-35632694 CAGGGTTCTCAGGGAGCTCCTGG - Intronic
1165902428 19:39175005-39175027 CTGGGTGGTCATGGAGTTCCTGG + Exonic
1167539348 19:50075318-50075340 CTGGGTGGTGATGGAGCTACAGG + Intergenic
1167594275 19:50418952-50418974 CAGGGCGAGCATGGTGGTGCCGG - Exonic
1167630362 19:50622540-50622562 CTGGGTGGTGATGGAGCTACAGG - Intronic
1168179160 19:54648516-54648538 GAAGAGGATCATGGAGCTGCTGG - Intronic
1202676064 1_KI270711v1_random:7970-7992 CAGGCTCAGCAGGGAGCTGCTGG - Intergenic
1202676252 1_KI270711v1_random:9518-9540 CAGGCTCAGCAGGGAGCTGCTGG - Intergenic
1202676435 1_KI270711v1_random:11064-11086 CAGGCTCAGCAGGGAGCTGCTGG - Intergenic
925014860 2:515045-515067 CAGGGTGATCACCTAGCTCCTGG - Intergenic
925148615 2:1599811-1599833 CTGGGTGAGCAGGGAGCAGCAGG - Intergenic
925413962 2:3656637-3656659 CAGGGCGATGCTGGGGCTGCTGG - Intergenic
925626827 2:5849864-5849886 CTTGGTGATGATGGAGCTGTGGG - Intergenic
925839497 2:7978543-7978565 CAGGCTGATCAAGGAGCATCTGG - Intergenic
926982324 2:18584952-18584974 CCGGGAGCTCGTGGAGCTGCTGG + Exonic
927683464 2:25155145-25155167 CAAGGTGTTCCTGGAGCTTCTGG + Exonic
927825883 2:26310043-26310065 CAGGGAGATGGTGGAGCTGGGGG + Exonic
931619463 2:64195258-64195280 CAGGGTCATTTTGGAGCTCCAGG + Intergenic
931925007 2:67062855-67062877 CAGGGTCACCATGGAGCAGCTGG + Intergenic
932822262 2:74911612-74911634 CAGGGTCAGCAGGCAGCTGCAGG - Intergenic
934492176 2:94769011-94769033 AAGGGTGATTTTGGAGCTGTAGG - Intergenic
936087596 2:109479886-109479908 CAGGGAGATCCTCGTGCTGCAGG - Intronic
936274217 2:111079476-111079498 CAGGATGGTCATGGAGAGGCAGG - Intronic
937228195 2:120381835-120381857 AAGGGTGACCAGGGAGCAGCCGG + Intergenic
937449775 2:121992600-121992622 CAGGATGATGCTGGAGGTGCTGG + Intergenic
938314406 2:130316021-130316043 CAGGGTGTGCTTGGAGCTGAGGG + Intergenic
938846655 2:135216647-135216669 CAGGCTGATCATTGAACTCCTGG + Intronic
940118791 2:150239782-150239804 CAGCGTGATCATGAAGTTGTAGG - Intergenic
941013924 2:160333122-160333144 CTGGGTGATGATGGAGGTGGGGG + Intronic
943529956 2:189066763-189066785 CAGGGTGATCCAGGAGTTCCAGG - Exonic
943897777 2:193388725-193388747 CAGGGTGAGCATGGAAGTACAGG + Intergenic
946759249 2:222976976-222976998 CTGGGTGATCATGAAATTGCAGG - Intergenic
947531399 2:230910765-230910787 CAGGTTGATCATGTAGATGGAGG + Exonic
947713679 2:232329621-232329643 CAGGGAGACCATGGGGGTGCTGG + Intronic
948097536 2:235348388-235348410 CATGGTGGTCCTGGAGCTGTGGG + Intergenic
948836867 2:240630116-240630138 CAGGTTGGTCATGTAGATGCGGG - Exonic
1169234945 20:3923241-3923263 CAGGGTTATTTTGGAGCTGTTGG + Exonic
1169492662 20:6084202-6084224 CAGGGTGATCACAGAGCAGCCGG - Intronic
1169745685 20:8940270-8940292 GAGGGTGATGGTGGAGATGCTGG - Intronic
1170644253 20:18182656-18182678 CAGGGTGATCATGGAGCTGCAGG - Intronic
1171258344 20:23709299-23709321 CAGGAGGACCAAGGAGCTGCAGG - Intergenic
1171420200 20:25012759-25012781 CAGGGGCATCATGGAGGTGTAGG + Intronic
1174062539 20:47843020-47843042 CATGGTTATCATGAAGCTCCGGG - Intergenic
1174073095 20:47912478-47912500 CATGGTTATCATGAAGCTCCGGG + Intergenic
1175632428 20:60552853-60552875 CATGGAGAGTATGGAGCTGCAGG + Intergenic
1176121241 20:63455521-63455543 CAGACTGAGCATGGAGCAGCGGG + Intronic
1176243717 20:64087055-64087077 CAGGCTGCTCTTGGAGCTCCTGG - Intronic
1176845787 21:13875584-13875606 AAGGGTGATTTTGGAGCTGTAGG - Intergenic
1177422186 21:20874296-20874318 CAGATTGATCATGGCCCTGCTGG - Intergenic
1178966797 21:37127761-37127783 CTGAGCGAACATGGAGCTGCAGG - Intronic
1179553789 21:42159931-42159953 CATCGTGATGATGGAGGTGCTGG + Intergenic
1180159301 21:45992007-45992029 CAGGGCGAGCCTGGAGCTGACGG + Exonic
1182047130 22:27284139-27284161 GAGTGAGATCATGGAGCTGCTGG + Intergenic
1183382950 22:37499616-37499638 CTGGGTCTTCAGGGAGCTGCAGG - Intronic
1183522352 22:38302941-38302963 CGTGATGGTCATGGAGCTGCTGG - Exonic
1183661078 22:39221640-39221662 TAGGGAGAGCATGCAGCTGCTGG - Intergenic
1184080523 22:42216271-42216293 TAGGGTGATCACTGAACTGCGGG + Intronic
1185379932 22:50503658-50503680 CAGGGTGCTGTTGGCGCTGCGGG + Exonic
950531986 3:13557577-13557599 GAGGGTGAGCCTGGAGCTGCTGG - Intronic
952157165 3:30655909-30655931 CCGGGTGATCCTGCTGCTGCTGG - Intronic
953901306 3:46845686-46845708 CAGGGTGTCCCGGGAGCTGCGGG + Intergenic
954134000 3:48573706-48573728 CAGGGTGGTCATGGAGACCCTGG - Exonic
954134744 3:48576734-48576756 AAGGGTGAGCGTGGAGCTCCTGG - Exonic
954636613 3:52074350-52074372 CAGGGTGCTCTGGCAGCTGCTGG - Intergenic
954672147 3:52296942-52296964 CTGGGAGATCACGGAGCTGATGG + Intergenic
960505449 3:118487991-118488013 AAGGGAGATCATGGAACTTCTGG + Intergenic
961509800 3:127393861-127393883 CAGAGTCTTCAGGGAGCTGCAGG + Intergenic
962812519 3:138971905-138971927 AAGGGTGATGCTGGAGCTGGCGG + Intergenic
965601514 3:170459058-170459080 AAGGGAGATCAGGGAGTTGCAGG + Intronic
968830308 4:2930237-2930259 CAGGGTGTCCAGGGAACTGCTGG + Intergenic
968982125 4:3855928-3855950 CAAGGGCATCATGGAGATGCTGG - Intergenic
969418002 4:7073665-7073687 CACTGTGAGCATGGAGCTCCAGG + Intergenic
972151179 4:36093053-36093075 CAGGGACATGATGGAGCTGGAGG + Intronic
972270115 4:37502715-37502737 CAGGGAGATGCTGCAGCTGCAGG + Intronic
973198612 4:47474586-47474608 CAGGGTGATCAAAGACCTTCAGG + Intergenic
974878246 4:67723127-67723149 CAAGGTGGTCAGGGAGCAGCTGG - Intergenic
977364107 4:96044910-96044932 CAGAGTCTTCATGCAGCTGCTGG + Intergenic
977542568 4:98335307-98335329 CAGGTTGGTCATGCAGTTGCTGG + Intronic
977598428 4:98909887-98909909 CAGGGTAATCATGGAGGAGGCGG + Intronic
978033733 4:103969673-103969695 CAGGGTGCCCATAGAACTGCTGG + Intergenic
979854850 4:125619127-125619149 CCGGGTGATACTGGTGCTGCTGG - Intergenic
986072078 5:4295394-4295416 AAGGTTGATCATGGACCTTCTGG + Intergenic
986477487 5:8150438-8150460 CAGGCTGATGATGCAGCTGGTGG + Intergenic
986515606 5:8560064-8560086 CAGGGTGATGCTGGAGGTGTTGG - Intergenic
987338982 5:16922611-16922633 GACGGTGACCATGGACCTGCTGG - Intronic
988706878 5:33735307-33735329 CAGGGTGATGCTGATGCTGCTGG + Intronic
988796708 5:34657865-34657887 CAGGGCGAACAGGGACCTGCAGG - Intronic
992635917 5:78725960-78725982 AAGGGTGATTATGGAGCAGAAGG + Intronic
992650630 5:78855759-78855781 CACGGTGTTGATGGGGCTGCTGG + Intronic
994447161 5:99891006-99891028 CAGGGTGAGCATGCTGTTGCAGG - Intergenic
997011226 5:129880787-129880809 CATTGTGAGCCTGGAGCTGCTGG - Intergenic
997900402 5:137758296-137758318 CTAGGTGATCATGCAGCAGCTGG + Intergenic
998337818 5:141389176-141389198 CAGGGTGATGCTGGAACTGGAGG - Exonic
1000379970 5:160620362-160620384 CTCGGTCATCATGGACCTGCTGG - Exonic
1000992142 5:167922356-167922378 AAGGGAGACTATGGAGCTGCAGG - Intronic
1001199155 5:169700018-169700040 CTGGGTGACCATGAAGATGCTGG + Exonic
1002067761 5:176660767-176660789 CAAGCTGATCAGGGAGCTGCTGG - Intergenic
1002162949 5:177327469-177327491 CAGGTTGATCTTGGAACTCCTGG - Intergenic
1002899131 6:1396152-1396174 CAGGGGGATCCCTGAGCTGCAGG + Intergenic
1003444120 6:6169312-6169334 CCAGGTGATGATGGTGCTGCTGG - Intronic
1004129792 6:12908727-12908749 CAGTGTGCTCATGGAACTGCAGG + Intronic
1007591863 6:43026460-43026482 CAGGCTGGTCTTGGAACTGCTGG - Intronic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1008725668 6:54415329-54415351 CAGGAACATGATGGAGCTGCAGG - Intergenic
1008858977 6:56126130-56126152 CAGGGTGATCGTGGACTTCCTGG - Exonic
1011702382 6:89967827-89967849 CAGAGAGATCATGGAGGGGCAGG - Intronic
1013068857 6:106710003-106710025 CAGGCTGATCCTGGAACTCCTGG - Intergenic
1013318536 6:108964184-108964206 CAGGTTCATGATGGCGCTGCTGG + Exonic
1014372766 6:120633089-120633111 CAGGGACATGATGGAGCTGGAGG + Intergenic
1014831239 6:126105259-126105281 CAAGGTGATGATGGAGCAGGAGG - Intergenic
1014844846 6:126262478-126262500 CAGAATGATCATGGAGCCTCAGG + Intergenic
1015392487 6:132698587-132698609 CAGGGTCAGCTTGGAGCTGAAGG - Intronic
1017114058 6:150960298-150960320 CAGCGAGATCATGGCGGTGCTGG + Exonic
1018825279 6:167404160-167404182 CAGGTTGGTCATGGAGCTCATGG + Intergenic
1019925927 7:4191745-4191767 CAGGGTGGACAGGGGGCTGCAGG + Intronic
1019945670 7:4327296-4327318 CAGGGAGATCATGGAGAGGGAGG - Intergenic
1020400353 7:7769872-7769894 GAGTGTGATCATGGTGCTGATGG - Intronic
1021281958 7:18731012-18731034 CATAGAGAGCATGGAGCTGCTGG + Intronic
1023622490 7:42087339-42087361 CAGGGTGTGCATGCATCTGCTGG - Intronic
1023704947 7:42931876-42931898 CGGGGTTAACATGGGGCTGCGGG - Intronic
1026208548 7:68280604-68280626 CAGGGTGATCATCAGGCTCCTGG - Intergenic
1026928529 7:74210197-74210219 CAGGGTGAGAGTGGGGCTGCGGG - Intronic
1028755280 7:94427014-94427036 CATGGTGATCAAGGTGCTCCTGG + Exonic
1029136749 7:98378385-98378407 CAGGTGGAGCATGCAGCTGCAGG - Intronic
1029245494 7:99196667-99196689 CAGGGTTACCATGGAGCTGAGGG - Intronic
1029353698 7:100034085-100034107 CAGAGTGAGGGTGGAGCTGCGGG - Exonic
1029378796 7:100199255-100199277 CAGCGTGGTCATGGAGCTAGGGG - Exonic
1029385793 7:100242740-100242762 CAGGGTGATTATGGAGAGGCAGG + Intronic
1030791443 7:113734071-113734093 CACGGTGCTCATGGAGCTTTGGG - Intergenic
1031101310 7:117483782-117483804 CAGGCTGCTCTTGGAGCTCCTGG + Intronic
1032867815 7:135945841-135945863 CAGTGTGCTTATGGAGATGCTGG - Intronic
1033214397 7:139483267-139483289 CTGGGCGCCCATGGAGCTGCAGG - Exonic
1034676079 7:152893941-152893963 CAGGGTGCTCGGGGAGGTGCAGG - Intergenic
1034816129 7:154173580-154173602 CAGGGAGAGCAGGGAGCAGCGGG - Intronic
1035449226 7:158964943-158964965 CAGGGTGACCCAGGAGCTGGAGG - Intergenic
1035642020 8:1191024-1191046 CAGGGTCATCCTGGACCTGCTGG - Intergenic
1036990239 8:13584282-13584304 GATGGTGGTCATGGAGCTGGTGG + Intergenic
1037362737 8:18091116-18091138 CAGGGTGAGGATGGAGGCGCAGG - Intergenic
1037577260 8:20219219-20219241 CTGGGTGATGTTGAAGCTGCTGG + Intronic
1042346017 8:67728834-67728856 CAGGCTGAGGATGGAGCTGGTGG + Intronic
1043133162 8:76487547-76487569 CAGGGTGATGCTGAGGCTGCTGG + Intergenic
1043323808 8:79025017-79025039 CAGGGTGATGCTGATGCTGCTGG - Intergenic
1045885852 8:107097218-107097240 CAGGGACATGATGGAGCTGGAGG + Intergenic
1047526089 8:125635345-125635367 AATGGTGGTCATGAAGCTGCAGG + Intergenic
1048027352 8:130598905-130598927 CTGGGTGCTCCTAGAGCTGCAGG + Intergenic
1048248610 8:132837738-132837760 CAGCGTGTGCATGGGGCTGCTGG + Exonic
1048616549 8:136081228-136081250 CAGGGAGCTCAGGGAGCTGAAGG - Intergenic
1049040965 8:140111378-140111400 TAGGGTGCTCATGGAGCTGGCGG - Intronic
1049535844 8:143181366-143181388 CAGGGGGACCACGCAGCTGCGGG - Intergenic
1049546440 8:143233847-143233869 CTGGGTGCTCATGAAGCTGGTGG - Intergenic
1049611697 8:143558861-143558883 CAGGTGGCTCATGGAGCTCCAGG + Intronic
1050242038 9:3646865-3646887 CAGGACAGTCATGGAGCTGCAGG - Intergenic
1050834692 9:10061870-10061892 CCGGGTGATAATAAAGCTGCAGG - Intronic
1051268959 9:15336296-15336318 CAACGTAATCTTGGAGCTGCTGG - Intergenic
1052894162 9:33731757-33731779 CAGGGCCATCAGGGAGCTGGGGG - Intergenic
1053446967 9:38159968-38159990 CTGGGTGAGGATGGAGGTGCTGG - Intergenic
1053665835 9:40316886-40316908 AAGGGTGATTTTGGAGCTGTAGG + Intronic
1053915415 9:42941935-42941957 AAGGGTGATTTTGGAGCTGTAGG + Intergenic
1054376990 9:64456915-64456937 AAGGGTGATTTTGGAGCTGTAGG + Intergenic
1054518776 9:66059397-66059419 AAGGGTGATTTTGGAGCTGTAGG - Intergenic
1056488741 9:87084643-87084665 CATGGTGGTCATGGAGCTGGCGG + Intergenic
1058835511 9:108855869-108855891 CAGGGTGACCCTGGAGAGGCAGG - Exonic
1059436265 9:114278377-114278399 GAGGGTGATGATGGTGCTGGTGG + Intronic
1061100276 9:128486842-128486864 CAGGGTGCTCAGGGCCCTGCTGG + Intronic
1062074100 9:134575125-134575147 CAGGGAAACCATGGAGGTGCTGG + Intergenic
1062079952 9:134618571-134618593 CAGGGTGGACATGAGGCTGCGGG + Intergenic
1185690503 X:2151354-2151376 CATGGTGGTCATGGAGCCACTGG + Intergenic
1186730437 X:12403713-12403735 CAGTGTGATCATGGTGCTGCTGG - Intronic
1192441377 X:71176926-71176948 CAGGGTGATGATGGTGGTTCAGG - Intergenic
1195065420 X:101234630-101234652 AGGGATGATCATGGAGCTGCCGG + Intronic
1195789248 X:108563879-108563901 CAGGGTGATGATGGAATTCCAGG + Exonic
1197311645 X:124912530-124912552 CATGGTGATTATGGTGTTGCAGG - Intronic
1199086697 X:143636006-143636028 CCGGATGATCTTGGAGCTGGGGG + Intergenic
1199436023 X:147813640-147813662 CAAGGTTATCATGGACCTCCTGG - Intergenic
1200278080 X:154752657-154752679 AATGGTGATCATGCAGCAGCAGG + Intergenic
1200988056 Y:9324976-9324998 CAGCGAGATGATGGAGCTGCAGG - Intergenic