ID: 1170644805

View in Genome Browser
Species Human (GRCh38)
Location 20:18188228-18188250
Sequence CCAGTCCTGCAGACCACACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 1, 2: 4, 3: 37, 4: 319}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170644805_1170644808 -3 Left 1170644805 20:18188228-18188250 CCCTGTGTGGTCTGCAGGACTGG 0: 1
1: 1
2: 4
3: 37
4: 319
Right 1170644808 20:18188248-18188270 TGGACTGTTTGCTGTGTTTGTGG 0: 1
1: 0
2: 0
3: 28
4: 265
1170644805_1170644810 23 Left 1170644805 20:18188228-18188250 CCCTGTGTGGTCTGCAGGACTGG 0: 1
1: 1
2: 4
3: 37
4: 319
Right 1170644810 20:18188274-18188296 TTGGCGATAGACTGTCAATTAGG 0: 1
1: 0
2: 0
3: 1
4: 40
1170644805_1170644809 4 Left 1170644805 20:18188228-18188250 CCCTGTGTGGTCTGCAGGACTGG 0: 1
1: 1
2: 4
3: 37
4: 319
Right 1170644809 20:18188255-18188277 TTTGCTGTGTTTGTGGATGTTGG 0: 1
1: 0
2: 3
3: 46
4: 475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170644805 Original CRISPR CCAGTCCTGCAGACCACACA GGG (reversed) Exonic