ID: 1170644805

View in Genome Browser
Species Human (GRCh38)
Location 20:18188228-18188250
Sequence CCAGTCCTGCAGACCACACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 1, 2: 4, 3: 37, 4: 319}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170644805_1170644810 23 Left 1170644805 20:18188228-18188250 CCCTGTGTGGTCTGCAGGACTGG 0: 1
1: 1
2: 4
3: 37
4: 319
Right 1170644810 20:18188274-18188296 TTGGCGATAGACTGTCAATTAGG 0: 1
1: 0
2: 0
3: 1
4: 40
1170644805_1170644809 4 Left 1170644805 20:18188228-18188250 CCCTGTGTGGTCTGCAGGACTGG 0: 1
1: 1
2: 4
3: 37
4: 319
Right 1170644809 20:18188255-18188277 TTTGCTGTGTTTGTGGATGTTGG 0: 1
1: 0
2: 3
3: 46
4: 475
1170644805_1170644808 -3 Left 1170644805 20:18188228-18188250 CCCTGTGTGGTCTGCAGGACTGG 0: 1
1: 1
2: 4
3: 37
4: 319
Right 1170644808 20:18188248-18188270 TGGACTGTTTGCTGTGTTTGTGG 0: 1
1: 0
2: 0
3: 28
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170644805 Original CRISPR CCAGTCCTGCAGACCACACA GGG (reversed) Exonic
900287923 1:1910615-1910637 CCAGACCCGCAGACCCCACAAGG - Intergenic
900707947 1:4092141-4092163 CCAGCCCTGCACACCCCACCAGG + Intergenic
900752308 1:4406315-4406337 CCACCCCTGCAGACCACACCTGG + Intergenic
900917275 1:5647552-5647574 GCACTCCTGCAGCTCACACAGGG + Intergenic
901462107 1:9398087-9398109 TCAGTCCTGCAGGGCACATAGGG - Intergenic
901643641 1:10705383-10705405 TCAGTCCTGCTGAGCACCCAGGG - Intronic
901687233 1:10949683-10949705 CTGGTCCTGCAGCCCACACCTGG + Exonic
902058219 1:13619735-13619757 CAAGTCCTCCAGCGCACACAAGG - Intergenic
902238854 1:15074986-15075008 CCTGTCCTGCCTACCTCACAGGG - Intronic
902248779 1:15139848-15139870 CCAGCCCCGCAGACTGCACAGGG + Intergenic
902583646 1:17425038-17425060 CCAAGCCTGCAGACCAGACTTGG + Intronic
903605241 1:24570746-24570768 CTGGTGATGCAGACCACACATGG + Intronic
905473550 1:38210160-38210182 CCAGTCCTGGAGAGGACACCTGG + Intergenic
906829544 1:49016852-49016874 ACTGTCCTTGAGACCACACATGG + Intronic
907252914 1:53155000-53155022 ACAGTCCTGCAGACCAGAGTGGG + Intergenic
910602143 1:89043513-89043535 CCAGTCCTGCAGACTAGAGTGGG - Intergenic
911488963 1:98538378-98538400 CCAGTTCTGCAGTCTCCACATGG + Intergenic
911537831 1:99121887-99121909 ACAGTCCTCTAGAGCACACAAGG - Intergenic
912058064 1:105631247-105631269 CCAGTCCCACCGACCACCCAAGG - Intergenic
912484781 1:110017562-110017584 CCAGGCCTGCAGAGCACAGATGG - Exonic
913014101 1:114715476-114715498 CTTGTCCTGCCTACCACACAGGG - Intronic
913695284 1:121318813-121318835 TCAGTCCTGCATTCCACACTGGG - Intronic
914142280 1:144961247-144961269 TCAGTCCTGCATTCCACACTGGG + Intronic
915185105 1:154098738-154098760 CCAGTCCCGCAGACCAGAGTGGG - Intronic
915751301 1:158213192-158213214 CCAGTTCTACAGACCACAGGGGG + Intergenic
916219926 1:162433500-162433522 CCAGTCCCACCGACCACCCAAGG + Intergenic
916758942 1:167799677-167799699 ACACTGGTGCAGACCACACAGGG + Intergenic
919156770 1:193775848-193775870 ACTGTCCTGCAGACCCCAGAAGG - Intergenic
919741747 1:200985056-200985078 CCTGTCCTGCGGGCCTCACAAGG - Intronic
920482615 1:206337192-206337214 TCAGTCCTGCATTCCACACTGGG - Intronic
921219584 1:212963604-212963626 CCAATCCAGCAGAGCTCACATGG - Intronic
922317844 1:224458274-224458296 CCTTCCCTGCTGACCACACAGGG - Intronic
924738817 1:246782567-246782589 CCAGGCCTGCAGAGCCCACCCGG - Intergenic
1062771438 10:104732-104754 CCAGTCCCGCAGACCAGAGTGGG - Intergenic
1062791004 10:306703-306725 CCAGGGCTGCTGACCACAGAGGG - Intronic
1063159582 10:3409395-3409417 CCAGTCCTGCACGCCTCACTGGG - Intergenic
1066101559 10:32122675-32122697 CCAGTCCTGCAGACCAGAGTGGG - Intergenic
1067716180 10:48692703-48692725 ACAGTCAGGCAGGCCACACAAGG - Intronic
1068279892 10:54854804-54854826 CCAGTTCTGCAGACCAGAGTGGG - Intronic
1068455589 10:57250188-57250210 CCAGTCCCGTCGACCACTCAAGG + Intergenic
1070192552 10:74125465-74125487 CTCCTCCTGGAGACCACACAGGG - Intronic
1070309068 10:75260263-75260285 CCAGTCCTTCAGAGGACAAAGGG + Intergenic
1070539686 10:77407169-77407191 CCAGTCCTGCTTCCCACACATGG - Intronic
1072431616 10:95377278-95377300 AAAGACCTGCACACCACACATGG - Intronic
1073920349 10:108451212-108451234 CCAGTGCTGAAGAACAGACAGGG + Intergenic
1073942849 10:108718070-108718092 TCAGTCCTGCAGACATCACTAGG - Intergenic
1074732518 10:116393700-116393722 CCAGTCCCACCGACCACCCAAGG + Intergenic
1075561901 10:123474100-123474122 CCAGGCCAGTGGACCACACAGGG - Intergenic
1076433686 10:130425169-130425191 CCTGCCCTGCAGACCACCCAGGG - Intergenic
1076655150 10:132019111-132019133 CCAATCCTGCAGACCAGAGAGGG - Intergenic
1077297653 11:1833639-1833661 CCTGGCCTGCTGACCTCACAGGG + Intronic
1077677797 11:4212417-4212439 CCAGTCCTGCATCCCAGTCAGGG + Intergenic
1078836427 11:15035018-15035040 CCAGTCCCGCAGACCAGAGTGGG - Intronic
1079726163 11:23883443-23883465 CCAGTCCCATAGACCACCCAAGG - Intergenic
1080264505 11:30387501-30387523 TCAGTGCTGCTGACCACACGGGG + Intronic
1081422127 11:42881731-42881753 CCAGTCCCATAGACCACCCAAGG + Intergenic
1082238839 11:49851859-49851881 CCGGTCCTCCGGGCCACACAGGG - Intergenic
1082243302 11:49892470-49892492 CCGGTCCTCCAGGCCACACACGG + Intergenic
1083066794 11:59932105-59932127 CCAGTCCCACAGACCCAACAGGG - Intergenic
1083464222 11:62834469-62834491 CCAGTCCTAGAGACCACCTATGG - Exonic
1083564467 11:63701576-63701598 CCAATCATGCAGAAGACACAGGG + Intronic
1084480647 11:69417954-69417976 CCAGTCCTGCAGCACACAGGTGG - Intergenic
1084760952 11:71270456-71270478 TCAGCCCTGCAGCCAACACAGGG - Intergenic
1084992633 11:72942335-72942357 ACAGTCCTGCAGACTGTACAGGG - Intronic
1085802578 11:79604240-79604262 CCACTGCTGCAGTCCACAGAGGG - Intergenic
1086043091 11:82501506-82501528 CCAGTCCCACTGACCACCCAAGG + Intergenic
1087194503 11:95292168-95292190 CCAGCCTTGCAGACCAAGCAAGG - Intergenic
1089062062 11:115633905-115633927 CCAGTCCCATCGACCACACAAGG - Intergenic
1089171903 11:116517861-116517883 AAAGGCCTGCAGACCACACTGGG + Intergenic
1089313074 11:117572834-117572856 CCTGCCCTGGAGACCTCACAAGG + Intronic
1089397679 11:118146327-118146349 CCAGTCCTGCAGATGCCCCAAGG + Intronic
1091160820 11:133418085-133418107 CCAGTCCTCCGAACCACAGATGG - Intronic
1091445579 12:542721-542743 CCAGTCCTGCAGAGGAGAAAGGG + Intronic
1092138110 12:6163727-6163749 GCAGGCCTGCAGACCACTCCTGG + Intergenic
1092215497 12:6678955-6678977 TCAGTCCTGTAGACGGCACAGGG + Exonic
1093047913 12:14471784-14471806 CCAGTCCCTCCCACCACACATGG + Intronic
1093189461 12:16057723-16057745 CCAGTCCCATAGACCACCCAAGG + Intergenic
1093683508 12:22030346-22030368 GCAGGCCAGCAGACCAGACATGG + Intergenic
1093927541 12:24923824-24923846 CCAGGTCTTCAGACCACACAGGG + Intronic
1094018081 12:25884998-25885020 CCAGTCCCGCAGACCAGAGTGGG + Intergenic
1099693456 12:85991379-85991401 CCAGTCCTGCAGACCAGACTGGG - Intronic
1101600381 12:106204562-106204584 GCAGCCCTGCATACCACAAAGGG + Intergenic
1102060412 12:109926830-109926852 CCAGTCCTGCAGACCTGAGTGGG + Intronic
1102965680 12:117123728-117123750 CCAGCCCTGCACTCGACACAAGG - Intergenic
1103678659 12:122676648-122676670 CCAGTCCCACTGACCACCCAAGG - Intergenic
1104582695 12:130022403-130022425 CCAGTCCCGTCGACCACCCAAGG + Intergenic
1104614457 12:130256666-130256688 CCAGTCCCGCCGACCACCCAAGG - Intergenic
1104977124 12:132557083-132557105 CCAGGAGTGCAGAGCACACAGGG - Intronic
1105041868 12:132967142-132967164 CCAGTCCCGCAGACCAGAGCGGG + Intergenic
1105424469 13:20282833-20282855 CCAGTCCTGCAGACCTGAGTGGG + Intergenic
1105501788 13:20979340-20979362 CCTGCCCTGCAGAGAACACACGG - Intronic
1105705439 13:22965159-22965181 CCAGGCCTGCAGTCCTGACAAGG - Intergenic
1105858341 13:24390143-24390165 CCAGGCCTGCAGTCCTGACAAGG - Intergenic
1107652635 13:42560074-42560096 CCAGTCCCGTCGACCACCCAAGG + Intergenic
1108596782 13:51956280-51956302 CCAGCCCTGCAGACCCCATGGGG + Intronic
1109124865 13:58505439-58505461 CCAGTCCTGTTGACCGCCCAAGG - Intergenic
1109441423 13:62379577-62379599 CCAGTCCCATAGACCACCCAAGG + Intergenic
1110999783 13:82164959-82164981 CCAGTCCCGTTGACCACCCAAGG - Intergenic
1111128387 13:83941958-83941980 CCATTCCTGCAGTGCACACATGG - Intergenic
1113246195 13:108398374-108398396 CTTGACCTGCAGAACACACATGG + Intergenic
1114243860 14:20894350-20894372 CCAGTCATGCAGACACCAGATGG + Intergenic
1117565688 14:56991365-56991387 CCAGTCCTATCGACCACCCAAGG + Intergenic
1118200098 14:63663632-63663654 CCAGCCCTGCAGACCAGAGTGGG - Intergenic
1118514454 14:66509450-66509472 TCAGACATGCAGAACACACACGG - Intronic
1118634343 14:67734089-67734111 CCAGTCCTGCTGCCCCCAGAGGG - Exonic
1120585780 14:86310911-86310933 CCATTGCTGCAGAACACACTGGG + Intergenic
1121695353 14:95908024-95908046 CCAGTCCTGCAGATCAAACTGGG - Intergenic
1121974048 14:98385875-98385897 CCAGTCCTGCTGACCAGAGTGGG + Intergenic
1122623072 14:103070724-103070746 CCGGTCCTGGAGACCCCACCAGG + Intergenic
1122742530 14:103880529-103880551 CCAGTCCCCAAAACCACACACGG - Intergenic
1124347862 15:28934388-28934410 CAAGGTCTACAGACCACACAAGG - Intronic
1127317210 15:57808365-57808387 CCTGTCCTGCAAACCACTCAGGG - Intergenic
1128263508 15:66249715-66249737 CTAGTTCTGGAGACCACACTTGG - Intronic
1128266166 15:66268367-66268389 CCAGTCCTCTAGAGGACACAGGG + Intergenic
1128598515 15:68975681-68975703 CCAGTCCCATAGACCACCCAAGG - Intronic
1128803057 15:70509333-70509355 CCACACCTGCAGGCCACTCAAGG - Intergenic
1129165877 15:73777117-73777139 CCATGGCTGCAGACCACACTGGG - Intergenic
1132986463 16:2770062-2770084 CCAGCCCTGCTTCCCACACACGG + Intronic
1133245049 16:4443095-4443117 GCTCCCCTGCAGACCACACAGGG - Exonic
1133352112 16:5108563-5108585 CCAGTCCCATAGACCACCCAAGG - Intergenic
1135280912 16:21152946-21152968 CCAGTCCCACCGACCACCCAAGG + Intronic
1138047205 16:53737867-53737889 CCAGTCACAAAGACCACACACGG - Intronic
1140269871 16:73456030-73456052 CCAGTCCTGGAGACCATATGTGG + Intergenic
1142263215 16:89052068-89052090 ACAGCCCTGCAGCCCACGCATGG + Intergenic
1142757114 17:2023140-2023162 ACAGACCTGCAGCCCAGACATGG + Intronic
1143521686 17:7447741-7447763 CCCATCCTGCTGACCCCACAGGG - Intronic
1144386613 17:14754048-14754070 CCTGTCCTGCTGACCTCATAAGG - Intergenic
1146024844 17:29310942-29310964 CCATTCCTGCACAAAACACATGG + Intergenic
1147374744 17:40016816-40016838 CCTGCCCTGCAGCCCACCCAGGG + Exonic
1148241291 17:46000874-46000896 CCACTCCCGCAGGCCAAACAGGG - Intronic
1151849420 17:76681623-76681645 ACAGCCCTGCAGACCTCAAATGG + Intronic
1151880191 17:76890020-76890042 CCAGGCCAGGAGACCACCCACGG - Intronic
1152103966 17:78318313-78318335 CCTGTCCGGAAGACAACACACGG - Intergenic
1152325029 17:79631108-79631130 TCCATCCTGCAGCCCACACAGGG + Intergenic
1152660985 17:81541832-81541854 CCAGTGCTGCAGCCCACACTGGG - Intronic
1153683648 18:7524288-7524310 CCACTCTTGCAGGCCACCCATGG - Intergenic
1153789645 18:8566137-8566159 CCAGTACTTCAGACCAAAAACGG - Intergenic
1156172012 18:34496591-34496613 CCACTCCTGCACCCCACACCTGG - Intronic
1156474280 18:37395780-37395802 CCAGTCCTGAGGCCCCCACATGG + Intronic
1157160810 18:45312855-45312877 CCAGAGTTGCAGACCACAGAGGG + Intronic
1158632981 18:59132218-59132240 CCAGTCTTGCAGACCAGAGTAGG + Intergenic
1158829672 18:61263692-61263714 CCACTCCTGCTGACACCACAGGG + Intergenic
1159962067 18:74563056-74563078 CCTGTCCTGCAGAGCAGACCTGG + Intronic
1160337997 18:78059915-78059937 TCAGACTTGCAGACCACAAAAGG - Intergenic
1161173224 19:2823892-2823914 CCAGTCCTACAGACCAGAGTGGG - Intronic
1161364958 19:3873316-3873338 CCATTCCTGGTGGCCACACATGG - Intergenic
1161809025 19:6460836-6460858 CCAGTCCTGATGACCACTAAGGG + Intronic
1164597638 19:29540525-29540547 CCTGTCCTGCAGTCAACACCTGG + Intronic
1164623464 19:29711589-29711611 CCAGCCTTGCAGACCAAGCATGG - Intronic
1164740652 19:30573206-30573228 CCAGCTCTGTTGACCACACAGGG - Intronic
1166599785 19:44083826-44083848 CCAGTCCTGAGGCCCCCACATGG + Intronic
1167851949 19:52208909-52208931 TCAAACCTGGAGACCACACAGGG - Intronic
1168466602 19:56607220-56607242 CCAGTCCTGCTGCCCAAGCAAGG - Intronic
925767731 2:7253167-7253189 CCAACACTGCAGACCACACAAGG - Intergenic
927443206 2:23134574-23134596 CCAGTCCTGCAGATCACACAAGG + Intergenic
927485779 2:23487595-23487617 CAAGTCCTGCAGATGATACAGGG - Intronic
927989359 2:27436586-27436608 CCTGAACTACAGACCACACATGG - Intronic
929659644 2:43770879-43770901 CAAGTCCAGCAGACCCCAAATGG + Intergenic
929694651 2:44103955-44103977 CAAAACCTGAAGACCACACAGGG - Intergenic
932440242 2:71730245-71730267 GCAGACCTGCAGACCTGACATGG - Intergenic
933724557 2:85419095-85419117 CGAGTCCTGCCGGCCACACAGGG - Intronic
935141233 2:100354708-100354730 CCAGAGCTGCAGATCTCACATGG - Intergenic
937769740 2:125706433-125706455 CCATTCCTCCATGCCACACAGGG + Intergenic
937979859 2:127608632-127608654 CCAGCCCTGCCTACCCCACAGGG - Intronic
941059347 2:160827789-160827811 CCAGCCCTGTGGCCCACACAAGG - Intergenic
941820848 2:169841882-169841904 CCAGTCCCGTCGACCACCCAAGG + Intronic
946290146 2:218738367-218738389 CCTTTATTGCAGACCACACAGGG + Exonic
948381165 2:237550888-237550910 CCAGTCATACAGAGGACACAAGG - Intronic
948993428 2:241565699-241565721 CCTGCCCTGCAGCCCTCACACGG - Intronic
1169344827 20:4821813-4821835 GCAGTCCAGCAGGCCTCACAGGG - Intronic
1170644805 20:18188228-18188250 CCAGTCCTGCAGACCACACAGGG - Exonic
1170723859 20:18908305-18908327 CCTGTCCTGCAGCCCTCACCTGG + Intergenic
1171236902 20:23534875-23534897 CCAGTCCTGCAGACCAGAGGGGG - Intergenic
1171902345 20:30869265-30869287 CCAGTCATGCTGAGCACTCAGGG + Intergenic
1172092514 20:32444086-32444108 CAAGTCTTGCAGAACACACAGGG + Exonic
1175210125 20:57348746-57348768 CCAGTCCCACGGACCACCCAAGG + Intergenic
1175330496 20:58160676-58160698 CCAGTCCCACAGACCACCCAGGG + Exonic
1175350603 20:58315384-58315406 CCAGTCCTGCATACCTCACACGG + Intronic
1176256799 20:64157202-64157224 CCAGAGCTGCATCCCACACACGG + Intronic
1176710775 21:10147478-10147500 CCTGTCCTGCAGGTCTCACAGGG + Intergenic
1178818139 21:35950423-35950445 CCAGTCCAGCAATCCACCCATGG + Intronic
1178839479 21:36127395-36127417 TCAGTCCTTCAGACCACAAAAGG + Intergenic
1178983295 21:37283197-37283219 CCAGTCCTATCGACCACCCAAGG - Intergenic
1180335728 22:11575234-11575256 CCAGTCATGCTGAGCACTCAGGG + Intergenic
1180857805 22:19059312-19059334 CCAGTCTTGCAGCCCCCACCGGG - Intronic
1181846355 22:25712274-25712296 CCACTGCTCCAGACCACAGAAGG - Intronic
1182101271 22:27659197-27659219 CCAGTCCTTTCGACCACACTGGG - Intergenic
1182108291 22:27704703-27704725 GCTGGCCTGCACACCACACATGG - Intergenic
1183705230 22:39471647-39471669 CCTGTCCCCCACACCACACAGGG + Intronic
1183945673 22:41324503-41324525 CCAGTCCTTCATTCCACAGAGGG - Intronic
1184144198 22:42599037-42599059 CCAGAGCTGCTGACCACAAAGGG + Intronic
1184650290 22:45916503-45916525 CCAGGGCTGCAGACGCCACAGGG + Intergenic
1184685391 22:46094508-46094530 CCTGTCCTGGGGGCCACACAGGG + Intronic
1184686614 22:46099208-46099230 CCAGTCCTGCCCAACCCACATGG - Intronic
1185210296 22:49566900-49566922 CCGGGGCTGCAGCCCACACAAGG + Intronic
1185312091 22:50161868-50161890 CCAGGCATGCAGAGCCCACAGGG + Intergenic
1185346091 22:50311446-50311468 CCAGTCCTGGAGCCCCCACCAGG - Exonic
1185362747 22:50418790-50418812 CCAGCCCTGCTGGGCACACAGGG - Intronic
950255176 3:11498747-11498769 TCAGCCCTTCATACCACACAGGG + Intronic
951074283 3:18370162-18370184 CCTCTCTGGCAGACCACACAGGG - Intronic
953486136 3:43298468-43298490 ACAGTTCTGCAGCACACACAGGG - Intronic
953607678 3:44422362-44422384 ACAATTCTGCTGACCACACATGG - Intergenic
954292533 3:49657276-49657298 GCAATCCTCCTGACCACACAGGG - Exonic
954665424 3:52248870-52248892 CTAGCACTGCAGAGCACACAGGG - Intronic
955343541 3:58143943-58143965 CCAAGCCTCCAGCCCACACAGGG - Intronic
957362136 3:79173671-79173693 CCAGTCCCACCGACCACCCAAGG + Intronic
960090874 3:113636931-113636953 CCTGTCCTGCATACTTCACAGGG - Intergenic
961107420 3:124253876-124253898 CCACTCCAGCAGACCAGTCAGGG - Intronic
962258054 3:133885613-133885635 GCAGTCCCGCAGAACACCCATGG + Intronic
962713438 3:138106967-138106989 CCAGCCCTGCCTACCTCACAGGG + Intronic
964472720 3:157071466-157071488 CCAGTGCTTGAGACCAAACATGG - Intergenic
965245185 3:166258479-166258501 CCAGTCCCGTCGACCACCCAAGG - Intergenic
966190958 3:177271740-177271762 CCAGTCCCATCGACCACACAAGG - Intergenic
966931888 3:184680823-184680845 CCACTCCTGCAGCCCATAAAGGG - Intronic
968538671 4:1151151-1151173 CCAGTCCTGCAGACCAGAGTGGG - Intergenic
968679316 4:1905727-1905749 CAACTCCTGCAGAGCACACATGG - Intronic
968964347 4:3761956-3761978 CCAGGCCTGCGGACAGCACATGG + Intergenic
968984751 4:3869027-3869049 CCACTGCAGCAGACCAAACATGG + Intergenic
969439380 4:7208291-7208313 CCAGCCCTCCAGCCCCCACAGGG + Intronic
969634116 4:8356105-8356127 CCCGGCCTGCAGACAGCACATGG - Intergenic
970180174 4:13383860-13383882 GCAGTCCTGCCTATCACACAGGG + Intronic
970649268 4:18159281-18159303 CCAGTCCCATAGGCCACACAAGG - Intergenic
970675507 4:18444403-18444425 CCAATCCTGGAGGTCACACAAGG + Intergenic
970825159 4:20263238-20263260 CCAGTCCAGCAGATAACACTTGG - Intronic
971792294 4:31184980-31185002 CCAGGCCTGTCGACCACCCAAGG - Intergenic
971905134 4:32716236-32716258 CCAGTCCTATCGACCACCCAAGG - Intergenic
972158826 4:36198370-36198392 CTAGTCCTGCAGACCACAGTAGG - Intronic
972747345 4:41949772-41949794 TCAGTACTGCAGTCCACAGAAGG + Intronic
973606766 4:52595109-52595131 TCACTCCTGCAGATGACACACGG + Exonic
973774560 4:54232044-54232066 GCCTTCCTGCAGACCCCACAGGG + Intronic
973846774 4:54920897-54920919 CCAGGCATGCAGACCACAGCTGG - Intergenic
974651510 4:64759343-64759365 CCAGTCCTGCAGACCAGAGTGGG + Intergenic
975913673 4:79297892-79297914 CCAGTCCTGCAGACCATAGTGGG + Intronic
976679943 4:87745609-87745631 CCAGTCCTGCAGACCAGAGGTGG - Intergenic
976815843 4:89148214-89148236 CCAGTTCTGCAGACCAGAGGAGG - Intergenic
977033921 4:91925002-91925024 CTAGTCCTGCAGACTAGAGAGGG + Intergenic
977717293 4:100196531-100196553 CCAGTCCTATCGACCACCCAAGG - Intergenic
978592941 4:110346063-110346085 CCACTCCTGCATACCACAATGGG - Intergenic
979295769 4:119031106-119031128 CCACTCCTGGAGACCAGACTGGG - Exonic
980087274 4:128404029-128404051 CCATTCCTGCTGGCAACACAGGG - Intergenic
980306298 4:131065132-131065154 TCAGTCCTCCAGACCAGACTGGG - Intergenic
980450147 4:132959270-132959292 CCTGTCCTGCAGAACACAGTGGG + Intergenic
981269575 4:142829393-142829415 CCAGTCCTGGGGACCTCACAGGG - Intronic
982814282 4:159866602-159866624 CCTGTCCTGCTCACCTCACATGG - Intergenic
984818334 4:183858311-183858333 CCAGGCTTGCAGCCCGCACAGGG - Intronic
985531515 5:436421-436443 CCAGTCCTGCCAACCAAACCTGG - Exonic
986304777 5:6507000-6507022 CCAGGCCAGCAGACCATAAAAGG + Intergenic
986782051 5:11075460-11075482 ACAGTCCTGCAAAGCACAGAAGG + Intronic
986912326 5:12573955-12573977 CCAGTCCCGTCGACCACCCAAGG - Intergenic
987355897 5:17062539-17062561 CCAGTCCCATAGACCACCCAAGG + Intergenic
987543888 5:19288094-19288116 CCAGTCCCGTCGACCACCCAAGG + Intergenic
988961252 5:36373767-36373789 GCAGGCCTGCAGGCCACATAAGG + Intergenic
990923482 5:60993898-60993920 CCAGTCTTGCAGACCAGAGAGGG - Intronic
991359297 5:65803147-65803169 CCAGTCCTGCAGACCAGAGTGGG - Intronic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
995495916 5:112742994-112743016 GCAGTCCTGGAGATCAGACACGG + Intronic
995596398 5:113753129-113753151 CCAGTCCTATCGACCACCCAAGG - Intergenic
996948072 5:129094366-129094388 CCGGTGCTGCAGCTCACACAAGG - Intergenic
997286190 5:132680421-132680443 CCAGGACAGCAGATCACACAAGG + Intronic
1003153359 6:3571274-3571296 CAAGTGCTGCAGACCAGAGAGGG - Intergenic
1003770096 6:9290454-9290476 CCAGTCCCGTCGACCACCCAAGG - Intergenic
1003973477 6:11321422-11321444 TCTGTCCTGCAGACCTCACTGGG - Intronic
1004037028 6:11933431-11933453 CCAGTCCTCTTGACCACCCAAGG + Intergenic
1004224450 6:13772839-13772861 CCAGTCCCGTCGACCACCCAAGG + Intergenic
1004474779 6:15961280-15961302 CCAGACTTGGAGACAACACAAGG - Intergenic
1004520832 6:16359261-16359283 CCAGTCCTGCCGACCAGAGTGGG + Intronic
1004568502 6:16822077-16822099 CCAGTGTTGGTGACCACACAGGG - Intergenic
1004745183 6:18502246-18502268 CCAGGCCTGCAGACCTTCCATGG - Intergenic
1005725010 6:28639795-28639817 CCAGTCCTATCGACCACCCAAGG - Intergenic
1007935337 6:45727586-45727608 CCAGACCCGAAGACAACACAGGG - Intergenic
1008038847 6:46774948-46774970 CCAGTCCCATAGACCACCCAAGG + Intergenic
1009242311 6:61197686-61197708 CTAGTCCTTCCCACCACACATGG - Intergenic
1009487080 6:64238247-64238269 CCAGTCCTGCCTAACACCCAAGG - Intronic
1010331975 6:74633833-74633855 CAAGTTCTGCACACCAAACAAGG - Intergenic
1011442017 6:87397673-87397695 CCCTTTCTGCAGACCACAGAAGG - Exonic
1012054404 6:94387182-94387204 CCAGTCCTGCAGCCCACTACTGG + Intergenic
1012866387 6:104623243-104623265 GCAGTCCTGCAGAGCTCTCAGGG - Intergenic
1013420417 6:109961943-109961965 CCAAACCAGCAGAGCACACAGGG + Intergenic
1015455659 6:133424298-133424320 CCAGTCCTGCAGACCAGAGTGGG - Intronic
1016259035 6:142145752-142145774 CCAGTGCTGTAGTCCACAGATGG - Intergenic
1016904205 6:149132800-149132822 CCAGTCCTGCAAACCACCTGTGG + Intergenic
1018696137 6:166393362-166393384 CCAGTCCCGTCGACCACCCAAGG - Intergenic
1021500772 7:21330019-21330041 CCAGTCCTGTAGAACAGAGAGGG - Intergenic
1022423444 7:30245994-30246016 CCAGTCCTGCTGACCAGAGGGGG - Intergenic
1022430125 7:30310753-30310775 TCAGTCCTGTATGCCACACAGGG - Intronic
1022481265 7:30744541-30744563 CAAGTCCTTCAGTGCACACAAGG - Intronic
1023079590 7:36514628-36514650 CCAGGCCTGCAGACTCCAGATGG + Intronic
1023699414 7:42877863-42877885 CCAGTCCTGCAGACCAGAGTGGG + Intergenic
1024000756 7:45187956-45187978 ACTGGCTTGCAGACCACACATGG - Intergenic
1024459906 7:49649323-49649345 ACAGTTCTGCAGGCCATACAGGG + Intergenic
1026469016 7:70678826-70678848 CCAGTCCTGAAGGCAACAGAAGG + Intronic
1026659269 7:72285004-72285026 GAAGCCCTGCAGAACACACAGGG - Intronic
1028142555 7:87289074-87289096 CCAGTCCTATCGACCACCCAAGG + Intergenic
1028233315 7:88330583-88330605 CCAGTCCTGCAGACTAGAGTGGG + Intergenic
1028628469 7:92905031-92905053 CCAGACCTGGAGCCCAGACACGG - Intergenic
1029609428 7:101618818-101618840 GCAGCCCTGCAGCCCACACCAGG + Intronic
1029707290 7:102282646-102282668 CCACCCCTGCAGCCCACCCATGG - Intronic
1029988223 7:104940503-104940525 CCAGTCCCATAGACCACCCAAGG + Intergenic
1030819259 7:114076861-114076883 CCAGTCCTATCGACCACCCAAGG - Intergenic
1031786585 7:126040931-126040953 CCAGTCCTGCAGACTGCAGTGGG + Intergenic
1031990014 7:128191435-128191457 CCTGCCCTGCCCACCACACAGGG - Intergenic
1032016609 7:128384099-128384121 CCAGGGCTGCAGAGCACACAAGG + Intergenic
1032208349 7:129889213-129889235 CCAGTCCTACACACCACAGTTGG - Intronic
1032441129 7:131943941-131943963 CCAGTGCTGCAGTCAACACGGGG - Intergenic
1032784943 7:135193514-135193536 CCAGCCCCGCGGACCACACTTGG + Intronic
1035113658 7:156505385-156505407 CCAGCCCTGCAGACCCCATAGGG - Intergenic
1035768930 8:2131050-2131072 CCTGTACTACAAACCACACAAGG - Intronic
1035833963 8:2728147-2728169 CCAGTCCCGCCGACCGCCCAAGG + Intergenic
1035899979 8:3448723-3448745 TCACTCCTGCACACCACAGAGGG + Intronic
1036007817 8:4686956-4686978 CCAGTCCTGAACGGCACACAGGG + Intronic
1036150281 8:6290674-6290696 CCAGTCCAGCACATAACACAGGG + Intergenic
1036566255 8:9940788-9940810 CCAGTCATGCAGACCTCTCTAGG + Intergenic
1036713325 8:11097440-11097462 CCAGCACTGCTGAACACACAGGG + Intronic
1036851258 8:12203395-12203417 CCAGTCCCTTCGACCACACAAGG - Intergenic
1036872622 8:12445669-12445691 CCAGTCCCTTCGACCACACAAGG - Intergenic
1038847553 8:31244159-31244181 CCAGTCCTATCGACCACCCAAGG - Intergenic
1039586646 8:38712681-38712703 CCGGTGCTGCAGCCCACACCTGG - Intergenic
1039587663 8:38720146-38720168 CCAGTCCCACCGACCACCCAAGG + Intergenic
1040014532 8:42689862-42689884 CCAGTCCCATAGACCACCCAAGG + Intergenic
1040106192 8:43543563-43543585 CCGGTCCTGCAGCCCACAGATGG - Intergenic
1040723178 8:50350268-50350290 CCAGTCCCACCGACCACCCAAGG + Intronic
1041205501 8:55494858-55494880 TCAGTCCTGCAGACCAGAGGGGG - Intronic
1042690215 8:71489998-71490020 CCAGTCCTGGAGATCACACTTGG - Intronic
1043568117 8:81570862-81570884 CCAGTCCTGCGGACCAGAGTGGG - Intergenic
1044880611 8:96719097-96719119 CCAGTCCTATCGACCACCCAAGG - Intronic
1044999933 8:97869885-97869907 CCAGTCCTGGAGACCCTACCAGG - Intronic
1045036785 8:98182117-98182139 CCAATCCTGCAGACTTCCCATGG - Intergenic
1045232273 8:100316785-100316807 CCAATCCCACAGACCACCCAAGG - Intronic
1046208831 8:111040848-111040870 CCAGTCCTGTAGACCACCCAAGG - Intergenic
1047872817 8:129103928-129103950 CCAGTCCTGCTGAGCAAAAAAGG + Intergenic
1047997903 8:130354350-130354372 CCAGGCCTGCTGTCGACACATGG - Intronic
1048367850 8:133753996-133754018 CCAGTCCTCCAGCCCACACATGG - Intergenic
1051463854 9:17354284-17354306 CCAGTCCCGTAGACCACCTAAGG + Intronic
1052758643 9:32567221-32567243 CCAGTTTTGCAGAGCACACCTGG - Exonic
1052979606 9:34438294-34438316 CCAGTCCCATCGACCACACAAGG + Intronic
1053647758 9:40133174-40133196 CCTGTCCTGCAGGTCTCACAGGG + Intergenic
1054536822 9:66242996-66243018 CCTGTCCTGCAGGTCTCACAGGG - Intergenic
1055744380 9:79426870-79426892 CCAGTCCTGCACAGCATAGAAGG - Intergenic
1055944385 9:81679846-81679868 CCACTTCTGGAGACCACAAAAGG + Intronic
1056082050 9:83105853-83105875 GCAGTCCTGCAGCCGGCACATGG - Intergenic
1056782843 9:89564314-89564336 CCAGGACTGCAGAGGACACACGG + Intergenic
1057815192 9:98289249-98289271 CCTGTCCTGCCTACCTCACAAGG - Exonic
1058365235 9:104200943-104200965 CCAGTCCCATCGACCACACAAGG + Intergenic
1059570058 9:115424924-115424946 ACAGTCCTCCAGACCCCAGAAGG - Intergenic
1060912564 9:127362575-127362597 CCAGTCTGGCAGAGCAGACACGG + Intronic
1062026408 9:134342675-134342697 TCAGCCCTGGAGACCACACATGG - Intronic
1202795535 9_KI270719v1_random:116466-116488 CCTGTCCTGCAGGTCTCACAGGG + Intergenic
1185745384 X:2568626-2568648 CAAGGCCTGCAGACCATACAAGG - Intergenic
1186371947 X:8955732-8955754 CCAGTTCAGCTGACCACATACGG + Intergenic
1188166908 X:26873712-26873734 CCAGTCCCATCGACCACACAAGG - Intergenic
1188812217 X:34664561-34664583 TGAGTCCTTCAGACCACAAAGGG - Intergenic
1190045815 X:47111015-47111037 CCAGTCCCATCGACCACACAAGG - Intergenic
1192251464 X:69417117-69417139 CCAGTCCCATAGACCACCCAAGG + Intergenic
1193919372 X:87406890-87406912 CCAGTCCCGCGGACCACAGTGGG - Intergenic
1196391305 X:115210279-115210301 CCTAGCCTGCACACCACACAGGG - Intronic
1198105173 X:133455096-133455118 CAAGACCTCCAGGCCACACAAGG + Intergenic
1199092321 X:143705994-143706016 CCAGTACTGTAGACCAGAGAGGG + Intergenic
1199134122 X:144231263-144231285 CCAGTCCCGTCGACCACCCAAGG - Intergenic
1199799467 X:151235301-151235323 CCAAGCCTGCAGTCCCCACAAGG + Intergenic
1200937034 Y:8747358-8747380 GGAGTCCTGCAGACCAAGCAGGG + Intergenic
1201299185 Y:12491154-12491176 CCAGTCTTGCACACCAGGCAGGG + Intergenic
1202137040 Y:21676675-21676697 CCAGTCCTATTGACCACCCAAGG - Intergenic