ID: 1170644809

View in Genome Browser
Species Human (GRCh38)
Location 20:18188255-18188277
Sequence TTTGCTGTGTTTGTGGATGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 475}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170644807_1170644809 3 Left 1170644807 20:18188229-18188251 CCTGTGTGGTCTGCAGGACTGGA 0: 1
1: 0
2: 1
3: 34
4: 210
Right 1170644809 20:18188255-18188277 TTTGCTGTGTTTGTGGATGTTGG 0: 1
1: 0
2: 3
3: 46
4: 475
1170644801_1170644809 17 Left 1170644801 20:18188215-18188237 CCCTCTAGATGTACCCTGTGTGG 0: 1
1: 0
2: 0
3: 9
4: 102
Right 1170644809 20:18188255-18188277 TTTGCTGTGTTTGTGGATGTTGG 0: 1
1: 0
2: 3
3: 46
4: 475
1170644805_1170644809 4 Left 1170644805 20:18188228-18188250 CCCTGTGTGGTCTGCAGGACTGG 0: 1
1: 1
2: 4
3: 37
4: 319
Right 1170644809 20:18188255-18188277 TTTGCTGTGTTTGTGGATGTTGG 0: 1
1: 0
2: 3
3: 46
4: 475
1170644803_1170644809 16 Left 1170644803 20:18188216-18188238 CCTCTAGATGTACCCTGTGTGGT 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1170644809 20:18188255-18188277 TTTGCTGTGTTTGTGGATGTTGG 0: 1
1: 0
2: 3
3: 46
4: 475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170644809 Original CRISPR TTTGCTGTGTTTGTGGATGT TGG Exonic