ID: 1170644810

View in Genome Browser
Species Human (GRCh38)
Location 20:18188274-18188296
Sequence TTGGCGATAGACTGTCAATT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170644805_1170644810 23 Left 1170644805 20:18188228-18188250 CCCTGTGTGGTCTGCAGGACTGG 0: 1
1: 1
2: 4
3: 37
4: 319
Right 1170644810 20:18188274-18188296 TTGGCGATAGACTGTCAATTAGG 0: 1
1: 0
2: 0
3: 1
4: 40
1170644807_1170644810 22 Left 1170644807 20:18188229-18188251 CCTGTGTGGTCTGCAGGACTGGA 0: 1
1: 0
2: 1
3: 34
4: 210
Right 1170644810 20:18188274-18188296 TTGGCGATAGACTGTCAATTAGG 0: 1
1: 0
2: 0
3: 1
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170644810 Original CRISPR TTGGCGATAGACTGTCAATT AGG Exonic