ID: 1170645117

View in Genome Browser
Species Human (GRCh38)
Location 20:18190953-18190975
Sequence TCCCCAAGGCTTAGCCAGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170645117_1170645126 -4 Left 1170645117 20:18190953-18190975 CCGCTCTGGCTAAGCCTTGGGGA No data
Right 1170645126 20:18190972-18190994 GGGAGGGGGCTGGGAGGTGTAGG No data
1170645117_1170645131 9 Left 1170645117 20:18190953-18190975 CCGCTCTGGCTAAGCCTTGGGGA No data
Right 1170645131 20:18190985-18191007 GAGGTGTAGGGGGTAGTTTAGGG No data
1170645117_1170645127 -3 Left 1170645117 20:18190953-18190975 CCGCTCTGGCTAAGCCTTGGGGA No data
Right 1170645127 20:18190973-18190995 GGAGGGGGCTGGGAGGTGTAGGG No data
1170645117_1170645128 -2 Left 1170645117 20:18190953-18190975 CCGCTCTGGCTAAGCCTTGGGGA No data
Right 1170645128 20:18190974-18190996 GAGGGGGCTGGGAGGTGTAGGGG No data
1170645117_1170645129 -1 Left 1170645117 20:18190953-18190975 CCGCTCTGGCTAAGCCTTGGGGA No data
Right 1170645129 20:18190975-18190997 AGGGGGCTGGGAGGTGTAGGGGG No data
1170645117_1170645124 -10 Left 1170645117 20:18190953-18190975 CCGCTCTGGCTAAGCCTTGGGGA No data
Right 1170645124 20:18190966-18190988 GCCTTGGGGAGGGGGCTGGGAGG No data
1170645117_1170645134 26 Left 1170645117 20:18190953-18190975 CCGCTCTGGCTAAGCCTTGGGGA No data
Right 1170645134 20:18191002-18191024 TTAGGGGGTCTGTGTGTGTCTGG No data
1170645117_1170645132 10 Left 1170645117 20:18190953-18190975 CCGCTCTGGCTAAGCCTTGGGGA No data
Right 1170645132 20:18190986-18191008 AGGTGTAGGGGGTAGTTTAGGGG No data
1170645117_1170645130 8 Left 1170645117 20:18190953-18190975 CCGCTCTGGCTAAGCCTTGGGGA No data
Right 1170645130 20:18190984-18191006 GGAGGTGTAGGGGGTAGTTTAGG No data
1170645117_1170645133 11 Left 1170645117 20:18190953-18190975 CCGCTCTGGCTAAGCCTTGGGGA No data
Right 1170645133 20:18190987-18191009 GGTGTAGGGGGTAGTTTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170645117 Original CRISPR TCCCCAAGGCTTAGCCAGAG CGG (reversed) Intergenic
No off target data available for this crispr