ID: 1170645121

View in Genome Browser
Species Human (GRCh38)
Location 20:18190958-18190980
Sequence CTGGCTAAGCCTTGGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170645110_1170645121 1 Left 1170645110 20:18190934-18190956 CCACAGCCTTCAGCCTTCACCGC No data
Right 1170645121 20:18190958-18190980 CTGGCTAAGCCTTGGGGAGGGGG No data
1170645109_1170645121 16 Left 1170645109 20:18190919-18190941 CCAGGCAGTCTGGTACCACAGCC No data
Right 1170645121 20:18190958-18190980 CTGGCTAAGCCTTGGGGAGGGGG No data
1170645106_1170645121 30 Left 1170645106 20:18190905-18190927 CCCTGAATTCAAAGCCAGGCAGT No data
Right 1170645121 20:18190958-18190980 CTGGCTAAGCCTTGGGGAGGGGG No data
1170645107_1170645121 29 Left 1170645107 20:18190906-18190928 CCTGAATTCAAAGCCAGGCAGTC No data
Right 1170645121 20:18190958-18190980 CTGGCTAAGCCTTGGGGAGGGGG No data
1170645112_1170645121 -5 Left 1170645112 20:18190940-18190962 CCTTCAGCCTTCACCGCTCTGGC No data
Right 1170645121 20:18190958-18190980 CTGGCTAAGCCTTGGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170645121 Original CRISPR CTGGCTAAGCCTTGGGGAGG GGG Intergenic
No off target data available for this crispr