ID: 1170657155

View in Genome Browser
Species Human (GRCh38)
Location 20:18298571-18298593
Sequence ATGGCTTGTGGGAGACATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 251}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170657144_1170657155 30 Left 1170657144 20:18298518-18298540 CCCTGCCAGCCCTATGGCAGGTA 0: 1
1: 0
2: 2
3: 17
4: 134
Right 1170657155 20:18298571-18298593 ATGGCTTGTGGGAGACATGGTGG 0: 1
1: 0
2: 1
3: 34
4: 251
1170657149_1170657155 2 Left 1170657149 20:18298546-18298568 CCTATATTCCTAGATCAGCTTCT 0: 1
1: 0
2: 0
3: 14
4: 206
Right 1170657155 20:18298571-18298593 ATGGCTTGTGGGAGACATGGTGG 0: 1
1: 0
2: 1
3: 34
4: 251
1170657148_1170657155 20 Left 1170657148 20:18298528-18298550 CCTATGGCAGGTAGCTGTCCTAT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1170657155 20:18298571-18298593 ATGGCTTGTGGGAGACATGGTGG 0: 1
1: 0
2: 1
3: 34
4: 251
1170657145_1170657155 29 Left 1170657145 20:18298519-18298541 CCTGCCAGCCCTATGGCAGGTAG 0: 1
1: 0
2: 0
3: 10
4: 199
Right 1170657155 20:18298571-18298593 ATGGCTTGTGGGAGACATGGTGG 0: 1
1: 0
2: 1
3: 34
4: 251
1170657151_1170657155 -6 Left 1170657151 20:18298554-18298576 CCTAGATCAGCTTCTGCATGGCT 0: 1
1: 0
2: 2
3: 13
4: 225
Right 1170657155 20:18298571-18298593 ATGGCTTGTGGGAGACATGGTGG 0: 1
1: 0
2: 1
3: 34
4: 251
1170657147_1170657155 21 Left 1170657147 20:18298527-18298549 CCCTATGGCAGGTAGCTGTCCTA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1170657155 20:18298571-18298593 ATGGCTTGTGGGAGACATGGTGG 0: 1
1: 0
2: 1
3: 34
4: 251
1170657146_1170657155 25 Left 1170657146 20:18298523-18298545 CCAGCCCTATGGCAGGTAGCTGT 0: 1
1: 0
2: 12
3: 33
4: 167
Right 1170657155 20:18298571-18298593 ATGGCTTGTGGGAGACATGGTGG 0: 1
1: 0
2: 1
3: 34
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170657155 Original CRISPR ATGGCTTGTGGGAGACATGG TGG Intronic
900547330 1:3236230-3236252 AGGGGCTGTGGGAGACAAGGAGG - Intronic
900955205 1:5882565-5882587 AGGGCATGTGGGCGACATGGAGG - Intronic
904604351 1:31690729-31690751 ATGGCTTGGGTTAGACACGGAGG - Intronic
904772462 1:32887776-32887798 ATGGCATGTGTGAGACATGTGGG + Intronic
906373585 1:45275166-45275188 ATAGCTTGTGGGAGCCAGGATGG + Intronic
907232275 1:53010869-53010891 ATAGGTTTTGGGAGAGATGGTGG - Intronic
907661827 1:56400281-56400303 AGTGCTTGTGGGAGGCATAGTGG + Intergenic
909879748 1:80859573-80859595 ACAGCTTGTGGGAGGCAGGGTGG + Intergenic
910652933 1:89589376-89589398 ATGGAAGGTGGGAGAAATGGAGG + Intronic
912637005 1:111305465-111305487 AGAGCTTGTGGGAGCCAGGGTGG - Intronic
913691737 1:121286072-121286094 ATGGCCTGTGGGCTGCATGGGGG - Intronic
914193702 1:145432346-145432368 ATGTCGTATGGGAGACACGGAGG - Intergenic
914475031 1:148015236-148015258 ATGTCGTATGGGAGACACGGAGG - Intergenic
914944578 1:152052736-152052758 ATGGCTTGTGCGCCACCTGGTGG - Intergenic
916442047 1:164836680-164836702 AAGGGTTGTGGGAGATATAGTGG - Intronic
917108266 1:171517593-171517615 GTTGCTTGTTGGAGAGATGGTGG + Exonic
917451540 1:175151464-175151486 TTGGCCTGTGGCAGAAATGGTGG + Intergenic
918830801 1:189395336-189395358 AAGGATTGTGGAAGACAGGGTGG + Intergenic
919656648 1:200203184-200203206 AGGTCTTGTGGCAGGCATGGAGG - Intergenic
919923833 1:202181961-202181983 CTGCCTTGTGGGGGCCATGGTGG + Intergenic
921536284 1:216352602-216352624 ATGGCTAGTAGAAGAAATGGGGG + Intronic
1063086923 10:2828261-2828283 TAAGCTTGTGGGAGAAATGGAGG + Intergenic
1066524237 10:36258713-36258735 ATGGGTGGTGTGTGACATGGAGG + Intergenic
1067064885 10:43098239-43098261 AGGGCTTGGGGGAGACAGGATGG - Intronic
1069421512 10:68250830-68250852 CTAGCCTGAGGGAGACATGGAGG - Intergenic
1071784409 10:88882245-88882267 ACGGTTTGTGGGAGGCTTGGAGG + Intronic
1072173211 10:92887945-92887967 ATGGGTTGTGGGTGACACGTGGG + Intronic
1072600603 10:96924169-96924191 CTGGCTTGTGGGAGAAAAGTAGG + Intronic
1073290739 10:102412049-102412071 ACGGCTTGTGGGGGACAGAGGGG + Intronic
1075768268 10:124912203-124912225 ATGGCTGGTGGGGGAAATGCTGG - Intergenic
1076525939 10:131112408-131112430 AGGGCTTGTGGGAGGCACAGTGG - Intronic
1076566328 10:131401993-131402015 AGGGATTGTGGGGGCCATGGAGG + Intergenic
1077239334 11:1502463-1502485 GTGCCTGGTGGGAGTCATGGGGG - Intergenic
1077260493 11:1616393-1616415 AGGTGTTGTGAGAGACATGGAGG + Intergenic
1077324690 11:1958687-1958709 GAGGCCTGTGGGAGACATGGGGG - Intronic
1079549997 11:21683669-21683691 GTGGATTGTGGGAGAGATGCAGG - Intergenic
1081162536 11:39767521-39767543 ATGGCAGATCGGAGACATGGTGG - Intergenic
1081868497 11:46372525-46372547 AGGTTTTGTGGGGGACATGGGGG + Intronic
1084457964 11:69279297-69279319 ATGGCTGGTGGGTAACATGATGG - Intergenic
1084458038 11:69279724-69279746 ATGGCTGGTGGATAACATGGTGG - Intergenic
1084458057 11:69279866-69279888 ATGGCTGGTGGATAACATGGTGG - Intergenic
1084458076 11:69280008-69280030 ATGGCTGGTGGATAACATGGTGG - Intergenic
1084940880 11:72612659-72612681 ATGGGTTGGGGGAGGGATGGTGG + Intronic
1084963049 11:72727238-72727260 ATGGCTTGAGAGAGCCATGCAGG - Intronic
1085299955 11:75452043-75452065 GTGGCTTGTGATAGCCATGGTGG + Intronic
1087904529 11:103680293-103680315 ATGGTTTGGGGGACACAGGGAGG + Intergenic
1088461354 11:110086742-110086764 CTGGCATGTGGAAGACATGCAGG - Intergenic
1089383273 11:118051295-118051317 CTGGCTTGTGGGAGACCCAGGGG - Intergenic
1089902655 11:122004177-122004199 CTGGCTTATGGTATACATGGTGG - Intergenic
1091274612 11:134342061-134342083 ACGGCTTTCGGGAGACAGGGTGG + Intronic
1202807669 11_KI270721v1_random:13864-13886 GAGGCCTGTGGGAGACATGGGGG - Intergenic
1094605328 12:31944433-31944455 ATGGTCTGTGTGAGTCATGGGGG - Intergenic
1097030086 12:56083602-56083624 ATCGCTTGTGGGAGGGTTGGAGG + Intronic
1098066112 12:66618412-66618434 CTGGCTGGTGGGGGATATGGAGG + Intronic
1098237370 12:68430399-68430421 TTAGGTGGTGGGAGACATGGTGG + Intergenic
1098715533 12:73825064-73825086 ATGTCTTGGGAGAGACCTGGTGG + Intergenic
1099258549 12:80346780-80346802 ATGGCATTTGGGAGACATTTGGG + Intronic
1099817132 12:87664235-87664257 ATGGCTGATGGGAGACAAGAAGG - Intergenic
1099822316 12:87728396-87728418 ATGCCTAGTGGGAGACAAGGGGG - Intergenic
1100327647 12:93554267-93554289 ATGGCTTGTTGGAGAAGTTGTGG + Intergenic
1101991127 12:109486087-109486109 AGAGCTTGTGGGAGACACTGCGG - Intronic
1102830048 12:115989864-115989886 ATGGATTTGGGGAGACAAGGAGG - Intronic
1105304060 13:19157007-19157029 ATGATTTTTTGGAGACATGGGGG + Intergenic
1106411063 13:29511753-29511775 AGGGGTTGTGGGAGACAGGAAGG + Exonic
1109395471 13:61752940-61752962 ATGGATTGAGGCAGATATGGAGG - Intergenic
1112349244 13:98619087-98619109 AGGGTTAGTGGGGGACATGGGGG + Intergenic
1113462176 13:110490192-110490214 ATCGCTTGAGAGAGATATGGAGG + Intronic
1114185878 14:20401829-20401851 CTGGCTTGTGAGAAACAAGGTGG + Intronic
1115229715 14:31146965-31146987 ATTGCTTGTGGGAGAAATACTGG - Intronic
1116127442 14:40806664-40806686 ATTGCTTCTGGCAGACATGATGG + Intergenic
1117662417 14:58021240-58021262 ATGGCTTGGGAGGGACATGGTGG + Intronic
1117695421 14:58357506-58357528 ATGGCTTGTGGGCCACAGGTTGG - Intronic
1118720324 14:68589473-68589495 GGGGCTTGTGGCAGTCATGGGGG - Intronic
1120054232 14:79903747-79903769 AGAGCTTGTGGGAGCCAAGGTGG - Intergenic
1120546102 14:85813299-85813321 CTGTCTTGTGGGAAGCATGGAGG - Intergenic
1122492824 14:102131275-102131297 GTGGCTTGTGGGAGAAATGAAGG - Intronic
1126162594 15:45628160-45628182 ATAGCTTGTGGGAGCCAGGGTGG - Intronic
1126687585 15:51261884-51261906 ATTGATTGGGGGAGAGATGGTGG - Intronic
1126967356 15:54070114-54070136 ATTGCCGGTGGGAGACATTGTGG - Intronic
1127694256 15:61429002-61429024 ATGGATTTTGGGGGACTTGGGGG - Intergenic
1128985459 15:72217354-72217376 ATGGCCTGTAGGAAACAGGGAGG - Intronic
1129251176 15:74309789-74309811 ATGGCTGGTGGAGGACTTGGGGG - Intronic
1130243016 15:82214798-82214820 ATGCCATGTGGGGGACTTGGGGG + Exonic
1130368984 15:83267028-83267050 CTGGCTTGTTGGATACATGGGGG + Exonic
1130457432 15:84126497-84126519 ATGCCATGTGGGGGACTTGGGGG - Intergenic
1131344577 15:91634114-91634136 CTGGGGTGTGGGAGACATGCAGG + Intergenic
1131575643 15:93587906-93587928 ATGGCTTGTGTGAGAGCTGATGG + Intergenic
1131581236 15:93645807-93645829 ATGGCTTTCGGGAGACCTGGAGG + Intergenic
1131768830 15:95712287-95712309 AGGGGTTGTTGGAGACATGGAGG + Intergenic
1132931739 16:2462250-2462272 TGGGCTTGTGGGAGCCCTGGGGG + Intronic
1132992755 16:2805520-2805542 ATGGATTGGGGGTGCCATGGAGG + Intergenic
1133267239 16:4592401-4592423 AGGGCTTGTGGGGCCCATGGAGG + Intronic
1133390211 16:5404055-5404077 TTGGCTTGTCTGAGTCATGGGGG + Intergenic
1133769065 16:8857181-8857203 TATGCTTGTGGGAGACAGGGTGG - Intronic
1136008599 16:27347904-27347926 ATGGCTTTTAGGACACATGTGGG - Intronic
1137775236 16:51048669-51048691 GCATCTTGTGGGAGACATGGAGG + Intergenic
1137809336 16:51337910-51337932 TTGGCTTGTGGGTGACATCCTGG + Intergenic
1138539753 16:57680637-57680659 AGGGCGGGAGGGAGACATGGTGG - Intronic
1138756520 16:59492992-59493014 ATGGATAGTGGGAGACATAGTGG + Intergenic
1140447578 16:75043693-75043715 ATAGCATGTAAGAGACATGGGGG + Intronic
1140697257 16:77547426-77547448 ATGGATGGAGGGAGACAGGGAGG + Intergenic
1141026093 16:80550044-80550066 ATGTCTTCTGGTAGACCTGGGGG - Intronic
1141820678 16:86443294-86443316 ATGGCGTGTGGGGGACACTGTGG + Intergenic
1143102536 17:4512376-4512398 ATGGCTTCTGGGGGACAGGCAGG - Intronic
1144383826 17:14730281-14730303 ATTGCTTTTGGGAGAGAGGGTGG - Intergenic
1144830864 17:18130540-18130562 TTGGCTGGTGGTAGCCATGGGGG + Intronic
1145059126 17:19721204-19721226 CTGTCTGGTGGGAGACCTGGGGG - Intergenic
1145777639 17:27540501-27540523 ATTGCTAGTGGGAGGCTTGGCGG + Intronic
1146185991 17:30724570-30724592 ATGGCTGGAGGGAGACAAGGCGG + Intergenic
1146714522 17:35073477-35073499 AAGACTGGTGGGAGAGATGGTGG + Intronic
1146714579 17:35074244-35074266 AAGACTGGTGGGAGAGATGGTGG - Intronic
1147448198 17:40487796-40487818 AGGGCTCCTGGGAGTCATGGGGG - Intronic
1149451286 17:56751899-56751921 AGTGCTTGTAGGAGACATAGTGG - Intergenic
1151355577 17:73556020-73556042 AGGGGCTTTGGGAGACATGGGGG + Intronic
1152925636 17:83086479-83086501 ATGGTGGGTGGGAGACCTGGGGG + Intronic
1153151870 18:2105148-2105170 GTGGCATGTGGGAGCCATGAGGG - Intergenic
1153421488 18:4911221-4911243 ATAGCTTGTGGGAACCAGGGTGG + Intergenic
1155087729 18:22474253-22474275 ATGTCTTGAAGGAGAGATGGAGG - Intergenic
1155190088 18:23422099-23422121 AGAGCTTGTGGGAGATATTGTGG - Intronic
1155248504 18:23933992-23934014 CTGCCTTGTGGGAGATATTGGGG + Intronic
1155671751 18:28379947-28379969 AGAGCTTGTGGGAGGCAGGGTGG + Intergenic
1156125260 18:33897452-33897474 ATGTCTTTTGTGGGACATGGAGG + Intronic
1156236983 18:35215296-35215318 ATAGCTTGTGGAAGCCAAGGAGG - Intergenic
1156390682 18:36648059-36648081 ATGCCTGGAGTGAGACATGGTGG + Intronic
1156553139 18:38039637-38039659 GTGCCTTGTGGGAGCCCTGGGGG + Intergenic
1157247860 18:46070243-46070265 ATGTCTGGTGGGTGACATGCAGG - Intronic
1157441537 18:47715594-47715616 GTGGCTTGTGGGGGAAATGGGGG - Intergenic
1158393664 18:57063382-57063404 ATGCCTTGGGGCACACATGGAGG + Intergenic
1160625877 18:80204659-80204681 CTGGCTTGGGGCAGGCATGGTGG + Intronic
1161431254 19:4233592-4233614 AAGGCAGGTGGGAGCCATGGAGG - Intronic
1162972786 19:14191161-14191183 ATGGCTGGAGGGAGACAAGGCGG - Intronic
1163157083 19:15445466-15445488 AAGGCTGGTGGGAGGCCTGGGGG + Intronic
1163418895 19:17203289-17203311 AGGGGTGGTGGGGGACATGGAGG - Intronic
1163485034 19:17580477-17580499 AGGGCGTGAGGGAGCCATGGAGG - Intronic
1164540434 19:29117817-29117839 AGGGGTTGTGGGAGATGTGGAGG + Intergenic
1164951044 19:32337432-32337454 ATGGCTTGTTGGAAACAGGGTGG - Intergenic
1165204366 19:34171609-34171631 GTGGCTTGTGGGAGAAGTGTAGG + Intergenic
1165622175 19:37257256-37257278 ATGTCTTCTGGGAGACATAGTGG - Intergenic
1166133921 19:40763839-40763861 ACGGCCTGTGGGGGACATGGGGG + Intronic
1167148695 19:47696783-47696805 CAGCCGTGTGGGAGACATGGAGG - Intronic
1167623300 19:50570326-50570348 CTGGCCTGTGGGAGACCAGGAGG - Intergenic
1167782136 19:51605711-51605733 TTGGGTTGTGGAAGACATGAAGG + Intergenic
925357387 2:3251601-3251623 GTGACTTGTGGGAGAGATGGTGG - Intronic
925768881 2:7263170-7263192 GTGGCTTCTGGGAGACATCTGGG + Intergenic
928232498 2:29510980-29511002 AGGGCTAGTGAGAGAGATGGTGG - Intronic
929547442 2:42864783-42864805 ATGTCTTGTGTGATACATTGGGG + Intergenic
930948904 2:57112896-57112918 CTGGCTTGTGGGTGAGATTGTGG - Intergenic
931245499 2:60489404-60489426 AGGGCTTCTAGGAGACTTGGTGG - Intronic
933551347 2:83781027-83781049 ATAGCTTGTGGGAGCCAGAGAGG + Intergenic
933909526 2:86927632-86927654 AAGGCTTCTGGGAGACATCATGG + Intronic
934023199 2:87975747-87975769 AAGGCTTCTGGGAGACATCATGG - Intergenic
935800732 2:106692655-106692677 AAGGCTAGTGGGAGTCCTGGGGG - Intergenic
935809194 2:106780092-106780114 ACAGCTTGTGGGAGCCAGGGTGG - Intergenic
936413355 2:112280658-112280680 AAGGCTTCTGGGAGACATCATGG + Intronic
937442970 2:121932603-121932625 ATGTCTTGTGCGTGCCATGGAGG + Intergenic
938324157 2:130386540-130386562 ATGGCTTGTGGCAGCCATGCTGG + Intergenic
938740194 2:134224351-134224373 ATGTCTTCTGGAAGACAGGGAGG + Intronic
940955600 2:159723839-159723861 TTGGCATGTGGTAGAGATGGTGG - Intronic
945058558 2:205888705-205888727 ACGGGGTGTGGGAGAAATGGTGG + Intergenic
946476181 2:220008692-220008714 TTTGCTTGTGAGAGTCATGGAGG + Intergenic
947825910 2:233105839-233105861 CTGGCTTGTTGGAGAGATGGTGG + Intronic
1169615898 20:7445227-7445249 ATGGCTTGTTGGGGACAGGCAGG - Intergenic
1170657155 20:18298571-18298593 ATGGCTTGTGGGAGACATGGTGG + Intronic
1171077839 20:22147254-22147276 ATGGCAGGTGGGAGGCCTGGGGG - Intergenic
1171283525 20:23920300-23920322 ATGCCTTGTGGGTGACAGTGTGG - Intergenic
1173436882 20:43041490-43041512 CTGGCTTTGGGGAGACAGGGCGG - Intronic
1173905329 20:46624107-46624129 ATGCCTTGTGGGAGACAGTGAGG - Intronic
1174414870 20:50360028-50360050 AAGGCTCTTGGGGGACATGGGGG - Intergenic
1174892671 20:54413408-54413430 AGGGCTCTTGGGAGAAATGGGGG - Intergenic
1176030412 20:63008711-63008733 AGGGCTGGTGGGGGCCATGGGGG + Intergenic
1177634640 21:23771622-23771644 ATGGCTTTTGTCAGCCATGGTGG + Intergenic
1178584744 21:33862579-33862601 AAGGCTTGAGGGCGAGATGGCGG + Intronic
1178886627 21:36489884-36489906 ATGGCTTGAGGGAGGGTTGGTGG - Intronic
1180571988 22:16732999-16733021 ATAGCTTCAGGGAGTCATGGAGG - Intergenic
1180629218 22:17215793-17215815 AAGGGTTGGGGTAGACATGGGGG + Intronic
1181039269 22:20184281-20184303 AGGGCCTGTGGGATGCATGGGGG - Intergenic
1181476136 22:23168828-23168850 TTGTCTTCTGGGATACATGGTGG + Intergenic
1181626563 22:24126067-24126089 ATGGCTTGTGGGACAGTTGTGGG - Intronic
1181644705 22:24225102-24225124 ATGGCCTGGGGGAGAGATGAGGG + Exonic
1181752351 22:24997561-24997583 ATGGCTTGTGGGAGGCTGGTGGG + Intronic
1182039194 22:27223251-27223273 ATGCCTAGTGGGAGAGACGGAGG + Intergenic
1182129288 22:27839194-27839216 ATGGCATGGGTGAGACAGGGAGG + Intergenic
1182909355 22:33968254-33968276 ATGGCTTGTAAGAGAGAAGGAGG + Intergenic
1183671300 22:39274411-39274433 AGGGACTGTGGGAGACCTGGGGG - Intergenic
950089398 3:10284785-10284807 AGCGCTTGTGGGAAACATGCAGG - Intronic
950332582 3:12168271-12168293 ATGGGAGGTGGGAGAGATGGAGG + Intronic
950802721 3:15567505-15567527 ATGGCTTCTGCCAGTCATGGTGG - Intronic
951229540 3:20160998-20161020 ATGTGTTGGGGGAGAGATGGAGG - Exonic
952252044 3:31664832-31664854 ATGGCTTTGTGTAGACATGGGGG - Intronic
952954002 3:38545376-38545398 ATGACTTGTCAGAGACAGGGTGG - Intergenic
953181929 3:40603833-40603855 ATGGCTTGTGGGAAACTTGATGG + Intergenic
953473703 3:43188213-43188235 AGGGTTTGTGGGAGACACAGAGG + Intergenic
953606197 3:44414901-44414923 TTGGCTGGTGAGAGACAAGGGGG - Intergenic
954082592 3:48221377-48221399 TTGGCCTGTGGGACACTTGGGGG - Intergenic
954932350 3:54295243-54295265 ATGACTTGTAGGAGACAGGTAGG + Intronic
955411922 3:58661347-58661369 CTGGCTGGTGAGAGACATGGGGG - Intronic
955528578 3:59848116-59848138 ATGGCTTGTGGGAGCCACGGTGG - Intronic
956735826 3:72237380-72237402 ATGGATTTTGGCATACATGGGGG - Intergenic
957132295 3:76238541-76238563 ATGTCTAGGGGGAGACCTGGGGG - Intronic
957132332 3:76238699-76238721 ATGTCTAGGGGGAGACCTGGGGG - Intronic
957273313 3:78058927-78058949 ATGCCTCATGGGAGACACGGGGG + Intergenic
957960025 3:87237219-87237241 ATGAATTGTGGGAGGCAGGGGGG - Intronic
958023885 3:88028042-88028064 AAGGCTTGTGGATGACATTGTGG - Intergenic
959457466 3:106580579-106580601 ATGGCCTGTGGGAAAGATGATGG + Intergenic
961191433 3:124965424-124965446 AGGGATAGTGGGAGACATTGAGG + Intergenic
962383435 3:134914576-134914598 GAGGGTTGTTGGAGACATGGGGG + Intronic
962866631 3:139452728-139452750 GTTGGTTGTGGGGGACATGGGGG - Intergenic
964143659 3:153433022-153433044 ATGGATTTAGGGAGTCATGGGGG - Intergenic
966933285 3:184689678-184689700 AAGGCCTGTGGGAGACATGCGGG + Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
971219719 4:24693689-24693711 ATAGCTTATGGGAGACATGTAGG - Intergenic
971493326 4:27237443-27237465 ATGACTTGTGGGAATTATGGTGG + Intergenic
972164165 4:36261888-36261910 AGGGCTTGTGGGGGACCAGGAGG + Intergenic
973895652 4:55410075-55410097 AAGGCTGGTGGGAGGCAAGGAGG - Intronic
974262227 4:59540554-59540576 ATGGTATGTGGTAGAAATGGAGG + Intergenic
975443758 4:74439752-74439774 ATGGTCTGTGTGAGTCATGGGGG - Intergenic
976261412 4:83148553-83148575 ATGGCTAGAGGGATACAAGGTGG - Intergenic
976887156 4:90000039-90000061 ATGGCTTGTTGTAGACATTCTGG - Intergenic
979521158 4:121668552-121668574 ATGGCTTCTGTGAGTCATGGAGG - Intronic
980423154 4:132591106-132591128 ATGGCTTTTGGGAGAACAGGAGG - Intergenic
981029056 4:140105702-140105724 GTTGCCTGTGGGGGACATGGAGG + Intronic
987300938 5:16597707-16597729 GGGGCATGTGGGAGACATGTTGG - Intronic
988486351 5:31671104-31671126 ATGGATTGTAGCAGACATCGTGG - Intronic
989772567 5:45162165-45162187 GTAGCTTCTGGGAGACTTGGGGG + Intergenic
992202165 5:74395316-74395338 ATGGGGACTGGGAGACATGGGGG - Intergenic
992753567 5:79883389-79883411 ACAGCTTGTGGGAGCCAGGGTGG - Intergenic
993771305 5:91931304-91931326 ATGGCTTGTGATACACGTGGAGG + Intergenic
994739543 5:103600721-103600743 ATGGTATGTGGCGGACATGGAGG - Intergenic
995927960 5:117398402-117398424 ATGCCAAGTGAGAGACATGGAGG - Intergenic
996535905 5:124577572-124577594 AAGGCTTCTGGGAGACATTGGGG - Intergenic
1000407068 5:160899380-160899402 AAGGCTTTTGGGAGACAGGGTGG + Intergenic
1000513031 5:162207271-162207293 ATTGCTTCTGGGGGAAATGGAGG + Intergenic
1001965812 5:175909129-175909151 ATGGCAGGTGGGGGACATGGAGG - Intergenic
1002251134 5:177930071-177930093 ATGGCAGGTGGGGGACATGGAGG + Intergenic
1003619506 6:7685705-7685727 ATGGTTTGTGGAAGCCAAGGAGG + Intergenic
1004471892 6:15936958-15936980 GTGGTTTGTGGGAGACATTTGGG + Intergenic
1005970323 6:30755961-30755983 GTGGCTTCTGGAAGACATGCTGG - Intergenic
1006153530 6:32001887-32001909 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006159838 6:32034624-32034646 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006509471 6:34514237-34514259 ATGGCCTGTGGGAGAAGTGTCGG + Intronic
1007502032 6:42305683-42305705 ATGAATTGTGGGTGGCATGGAGG - Intronic
1007622873 6:43225602-43225624 CTGTCTTGTGTGAGTCATGGGGG - Intergenic
1007625515 6:43244052-43244074 AAGGCAGGTGGGAGGCATGGAGG - Intronic
1007633174 6:43283853-43283875 ATGGCGTCTGGGGGAGATGGTGG - Exonic
1012004695 6:93698108-93698130 ATGTATTGTGGAAGAGATGGTGG + Intergenic
1013671120 6:112404358-112404380 ACAGCTTGTGGGAGAGATGGAGG - Intergenic
1015235541 6:130966774-130966796 GTGGCTTGTGGGAGTCATATTGG - Intronic
1016878822 6:148889904-148889926 AGGGGTTGGGGGAGATATGGGGG - Intronic
1017820368 6:158044763-158044785 TTGGCATGAGGGAGACTTGGAGG - Intronic
1020403761 7:7807023-7807045 AGGGATTGTGTTAGACATGGTGG + Intronic
1020753901 7:12176684-12176706 ATGCCTTGCGGGAAACATGTTGG - Intergenic
1025255615 7:57382170-57382192 AAGGCTGTTGGGGGACATGGGGG + Intergenic
1025682203 7:63689508-63689530 AGGGCTTGGGCGAGGCATGGTGG - Intergenic
1026195526 7:68170199-68170221 CGGGCTGGTGGGAGACTTGGGGG + Intergenic
1026558134 7:71425762-71425784 ATGTATTGTGGGTGCCATGGAGG + Intronic
1027584959 7:80045955-80045977 ATGTCTTGGGAGGGACATGGTGG - Intergenic
1029524523 7:101086921-101086943 AGGCCTTGTGGCAAACATGGTGG - Intronic
1030100466 7:105941005-105941027 AGGGTCTGTGGGAGACCTGGGGG - Intronic
1031934581 7:127723482-127723504 ATGGCTTGTGAGGAAGATGGAGG + Intronic
1033243325 7:139699168-139699190 CAGGCTGGTGGGAGAGATGGCGG - Intronic
1036515571 8:9440373-9440395 ATGGCCTGTGGGTCACATGGAGG - Intergenic
1040372272 8:46788585-46788607 ATAGTTTGTGGGACCCATGGAGG + Intergenic
1040561939 8:48530336-48530358 ATGGCTTTGGGGTGGCATGGGGG - Intergenic
1042399893 8:68332390-68332412 ACTGCTTCTGGGAGACGTGGGGG - Intronic
1044529219 8:93289174-93289196 ATTGCTTGTGGAAGACATTTTGG + Intergenic
1045049743 8:98311917-98311939 GTGGCTTAGGGGAGACATAGGGG + Intergenic
1046170820 8:110502731-110502753 ATGGCATGTGTGAGTCGTGGTGG + Intergenic
1046608653 8:116399529-116399551 ATTGCCTGTGGGAGAGAGGGAGG + Intergenic
1046928849 8:119823353-119823375 ATGTGTTGTGGGAGACCTGGTGG + Intronic
1048081754 8:131135645-131135667 TTGGCTTGTGGTATCCATGGGGG + Intergenic
1048278137 8:133083012-133083034 GTGGCGTGGGGCAGACATGGAGG + Intronic
1049993195 9:1009508-1009530 GTGGCATGTGGGTGACATGCTGG + Intergenic
1052861244 9:33439185-33439207 AAGGCTCTTGGGAGAGATGGAGG - Intergenic
1055824202 9:80304335-80304357 TTGGCAGGTGGCAGACATGGAGG + Intergenic
1057195808 9:93115268-93115290 AGGGGTTGTGGGAGAGCTGGAGG + Intergenic
1057706442 9:97398383-97398405 GTGGCTTGGGGGAGCCCTGGAGG - Intergenic
1058598187 9:106638769-106638791 ATGGCATATGCAAGACATGGAGG + Intergenic
1059570643 9:115430824-115430846 GTGGCAGGTGGGAGACATTGGGG - Intergenic
1059734154 9:117085163-117085185 AAGGGTTGTGGGGGGCATGGAGG - Intronic
1061850846 9:133414304-133414326 GTGCCTTGTGGTAGTCATGGTGG - Intronic
1187942360 X:24394398-24394420 CTGGCAAGGGGGAGACATGGAGG + Intergenic
1190138586 X:47819832-47819854 ATGGCTTGTGGGGGAGCTGATGG - Intergenic
1192502643 X:71663971-71663993 AAGGGTTGGGGGAGACAGGGAGG - Intergenic
1193759514 X:85447182-85447204 ATGGCTTATGAAATACATGGTGG - Intergenic
1195146821 X:102026618-102026640 ATGGCTTGTGTGTGTCCTGGTGG - Intergenic
1196273431 X:113738633-113738655 ATGGCCTCTGAGAGACATGCTGG + Intergenic
1198526803 X:137509454-137509476 ATGGGCTGTTGGGGACATGGTGG - Intergenic