ID: 1170658122

View in Genome Browser
Species Human (GRCh38)
Location 20:18309613-18309635
Sequence TAGCCAGAGGCTCAGCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 283}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170658122 Original CRISPR TAGCCAGAGGCTCAGCCCTG TGG Intronic
900717302 1:4153229-4153251 AAGCCTGATGCCCAGCCCTGGGG - Intergenic
901323871 1:8355746-8355768 TCCCCAGAGGCTCTGCCCTCTGG - Intronic
901783195 1:11608188-11608210 CACCCACAGGCTCAGGCCTGGGG - Intergenic
902436609 1:16402086-16402108 AAGCAAGAGGCTCAGGCCTGAGG - Intronic
902612062 1:17603239-17603261 TAGCCAGATGGGCAGGCCTGCGG + Intronic
903031650 1:20467993-20468015 TAGGCTGAGGCTCAGCAATGGGG - Intergenic
904027602 1:27514244-27514266 TAGCGTGAGGCTCAGGCCAGAGG + Intergenic
904302130 1:29561262-29561284 CAGCTACAGGCTCAGGCCTGGGG - Intergenic
904401280 1:30258209-30258231 CAGTCACAGGCTCAGGCCTGGGG + Intergenic
911401344 1:97379119-97379141 TAGCCAGAGGCTCAGGACTGAGG + Intronic
919983332 1:202656242-202656264 AAGCCAGAGGCTGAACTCTGGGG + Intronic
920570801 1:207015877-207015899 TGGCGAGAGGCTCAGATCTGGGG - Intronic
921276350 1:213524419-213524441 GAGCCAGAGGCTCAGGCCCCTGG - Intergenic
1063736425 10:8760557-8760579 TAGTCTGAGGCTCTGCCCTCTGG + Intergenic
1064738622 10:18409550-18409572 CAGACAGAGTCTCAGCCCAGCGG - Intronic
1066995121 10:42556060-42556082 TGGGCAGAGGCTGAGCCATGCGG + Intergenic
1067027818 10:42859208-42859230 CTGCCAGAGGCTCTGCCCCGAGG + Intergenic
1067070374 10:43126478-43126500 CAGCCAGAGCCTCTGCCCTGAGG + Intronic
1068768785 10:60797270-60797292 TAAACAGAGGCTCAGCCGTTTGG + Intergenic
1071076542 10:81760578-81760600 TTGCCAGAGGGTCAGGGCTGGGG - Intergenic
1073199904 10:101726987-101727009 AAGCCAGTGGCTTAGCCCAGTGG + Intergenic
1073775651 10:106782831-106782853 CAGCCCCATGCTCAGCCCTGTGG - Intronic
1074974089 10:118566436-118566458 GTGCCAGACGCTAAGCCCTGGGG - Intergenic
1075337312 10:121617730-121617752 ACGGCAGTGGCTCAGCCCTGAGG - Intergenic
1075674907 10:124289669-124289691 CAACCAGGGTCTCAGCCCTGGGG + Intergenic
1075906112 10:126083391-126083413 TGCCCAGAGGCCCTGCCCTGGGG - Intronic
1076411378 10:130253771-130253793 CAGGCAAATGCTCAGCCCTGTGG - Intergenic
1076889625 10:133277235-133277257 TGGGCATAGGTTCAGCCCTGTGG + Intergenic
1077103584 11:832671-832693 TAGCCAGAGGCCCTGGGCTGTGG - Intergenic
1077350407 11:2090571-2090593 TAGCCAGATGAGCAGGCCTGTGG - Intergenic
1077441877 11:2572630-2572652 CAGAATGAGGCTCAGCCCTGGGG - Intronic
1080266756 11:30409188-30409210 AAGCCAGAGACTCAGGCCTCTGG - Intronic
1083042722 11:59703196-59703218 TAGACAGAGGCTTAGCCCTGAGG + Intergenic
1083634111 11:64110926-64110948 CAGCCCGAGGCTGAGCCCTCTGG - Intronic
1083965595 11:66042130-66042152 TGGAGAGAGGCTCAGCCCTAGGG - Exonic
1084483076 11:69433226-69433248 TAACCAGGGGCTCCACCCTGAGG + Intergenic
1084572557 11:69968326-69968348 GAGGCAGAGGGTCATCCCTGGGG - Intergenic
1084717334 11:70882342-70882364 TAGCTACAGGCACAGCCCAGGGG - Intronic
1085030790 11:73269797-73269819 GAGGCAGAGGCATAGCCCTGAGG - Intronic
1086926817 11:92649629-92649651 TAGCCAGACCCTCATCACTGTGG + Intronic
1089169914 11:116504781-116504803 TAGACACAGGCTCTGCTCTGCGG + Intergenic
1089922629 11:122224668-122224690 TTGCCAGAGAGTCAGCCATGGGG + Intergenic
1090831894 11:130426187-130426209 TAGCCAGAGGGGCAGCCACGTGG + Intronic
1090979425 11:131704274-131704296 AAGCCCGAGGCTCATCCATGGGG + Intronic
1091448578 12:558929-558951 GTGCCAGATGCTCTGCCCTGTGG + Intronic
1092171036 12:6374269-6374291 CAGGCAGAGCCTCAGACCTGAGG - Intronic
1092892541 12:12982158-12982180 TAGCCAAAGGCCCTGCCCTTGGG + Intronic
1095434679 12:42174505-42174527 TATCCAAAGACTCAGTCCTGAGG - Intronic
1095899299 12:47311377-47311399 TAGCCAGGGGCACACACCTGTGG + Intergenic
1096515634 12:52153682-52153704 AACCCTAAGGCTCAGCCCTGGGG + Intergenic
1096533517 12:52256640-52256662 AAGCCATAGGCCCTGCCCTGAGG - Intronic
1097277421 12:57822889-57822911 TAGCCATAGTCTCAAACCTGTGG - Exonic
1101236981 12:102799527-102799549 TTGGCAGATGCTCAGCCTTGGGG - Intergenic
1101721264 12:107352591-107352613 TAGCCCCAGGCTCTGCACTGGGG - Intronic
1102188948 12:110971401-110971423 TAGCCAGTGGCTTAGCCCAGAGG + Intergenic
1102284828 12:111647616-111647638 TAGCCAGAGGCCAAGCACGGTGG + Intronic
1104038234 12:125113330-125113352 GAGCCAGAGGCTCACATCTGTGG + Intronic
1104811581 12:131622938-131622960 CAGCGACAGGCTCTGCCCTGAGG + Intergenic
1104922002 12:132295399-132295421 CAGGCAGAGTCCCAGCCCTGGGG + Intronic
1104948652 12:132428788-132428810 CAGCCTGCAGCTCAGCCCTGCGG - Intergenic
1106270874 13:28152294-28152316 AAGTCAGAGGCTGGGCCCTGTGG + Intronic
1106298519 13:28440418-28440440 TAGCCAGAGGTTCAGCCTTCAGG - Intronic
1106486537 13:30177971-30177993 TACCAAGAGGCTCAGGCCTGTGG + Intergenic
1106755822 13:32821791-32821813 TCGCCAGCGGTTCATCCCTGGGG + Intergenic
1107442691 13:40442408-40442430 TAGTAACAGGATCAGCCCTGGGG + Intergenic
1108119162 13:47164585-47164607 TTTCCAGAGCCTCAGCCATGTGG + Intergenic
1109775618 13:67037343-67037365 TATCCCCAGGCTCAGCTCTGAGG - Intronic
1112383516 13:98916343-98916365 TAGACAGAGGTTCAGCTCTGAGG + Intronic
1113740684 13:112710598-112710620 AACCCAGCAGCTCAGCCCTGCGG - Intronic
1114413820 14:22525650-22525672 CCGACAGAGGCTCAACCCTGGGG + Intergenic
1114460760 14:22884838-22884860 GAGCCAGAGGATGAGGCCTGAGG - Exonic
1114516398 14:23302471-23302493 TAGCCAGCGGCCCAGCCTCGAGG - Exonic
1114617847 14:24077661-24077683 CAGCCAGGGCATCAGCCCTGGGG + Exonic
1117226862 14:53670150-53670172 TAGACAGACGTCCAGCCCTGAGG + Intergenic
1118639973 14:67783107-67783129 CAGCCAGAGGCACCTCCCTGCGG + Exonic
1119152556 14:72375571-72375593 TAGACAGAGTAACAGCCCTGTGG + Intronic
1119652956 14:76396745-76396767 CAGACAGAGGCTTAGCCCGGAGG + Intronic
1120230284 14:81834349-81834371 TAACCAGAGTCTCTGCCATGTGG - Intergenic
1121114736 14:91335632-91335654 TCCCCAGAGGCTAAGCCCTGTGG + Intronic
1121258925 14:92552445-92552467 TAGCTGGAAGCCCAGCCCTGGGG + Intronic
1122093949 14:99357667-99357689 TGGCCAGGGACTCAGCCCTAAGG - Intergenic
1122272206 14:100573337-100573359 TCGCTAGAGGAGCAGCCCTGCGG + Intronic
1122705370 14:103617474-103617496 TGGCCTGAGTCTCAGCACTGTGG - Intronic
1122929489 14:104926850-104926872 TTGGCCCAGGCTCAGCCCTGGGG + Intronic
1123164567 14:106314286-106314308 TTGCCAGGGTCACAGCCCTGTGG - Intergenic
1124159433 15:27255178-27255200 TTGCCTGAGGATGAGCCCTGTGG - Intronic
1125380960 15:39086197-39086219 TAGCCAGGGGATCGGCCTTGTGG - Intergenic
1125918739 15:43511712-43511734 CAGCCACAGGCACAGCACTGGGG - Intronic
1127852337 15:62924748-62924770 CAGCCACAGGCTGAGCCCTCAGG + Intergenic
1128519390 15:68365419-68365441 TAGGGAGAGGGTCAGCTCTGCGG + Intronic
1128944854 15:71813234-71813256 CAGCCAGAGGCTCAGAGCTCTGG - Intronic
1129299665 15:74618365-74618387 TAGCCAGAGGGTTAGCCATCTGG - Intronic
1131075713 15:89493770-89493792 GAGCGAGAGGAGCAGCCCTGGGG - Intronic
1132578099 16:673136-673158 TACCCAGTAGCGCAGCCCTGGGG + Intronic
1132927036 16:2436131-2436153 GAGCCAGAGCCTCAGCACGGGGG + Intronic
1132984649 16:2758574-2758596 TAGCCAGAGGACCAATCCTGTGG + Intronic
1133056828 16:3149617-3149639 AAGCCAGGGGCTCTCCCCTGGGG + Intronic
1133998862 16:10767138-10767160 TCGCCAGCAGCTCAGGCCTGGGG + Exonic
1134613188 16:15627330-15627352 TAGCCAGAGGCTGGGCACGGTGG + Intronic
1135490669 16:22906533-22906555 TAGCCCAAGGCTCTGCCCTGTGG - Intronic
1136452269 16:30360010-30360032 TAGCCAAAGGCGGAGCCCCGGGG - Intronic
1136856825 16:33665771-33665793 CTGCCAGAGGCTCTGCCCTGAGG - Intergenic
1137530645 16:49276822-49276844 TAGCCCGAGGCTTAGCACTCAGG + Intergenic
1137621829 16:49881318-49881340 GAGCCAGAGGACCAGACCTGAGG + Intergenic
1138121469 16:54403914-54403936 TACCCAGGGGCTGAGCCCGGAGG - Intergenic
1138197082 16:55059677-55059699 GACCCAGAGGCCCAGCCCAGTGG - Intergenic
1140956073 16:79867261-79867283 TTGTCAGAGGTTCAGCTCTGTGG + Intergenic
1141021248 16:80498427-80498449 TAGCCACAGGCTCGGACCTTGGG - Intergenic
1141427364 16:83952985-83953007 TAGCCAGACCCCCATCCCTGGGG - Intronic
1141720615 16:85753281-85753303 TGGCCCAAGCCTCAGCCCTGGGG + Intergenic
1141787248 16:86209781-86209803 AAGCCAGAGGCCCAGGGCTGTGG - Intergenic
1203118398 16_KI270728v1_random:1514246-1514268 CTGCCAGAGGCTCTGCCCTGAGG - Intergenic
1143646181 17:8231848-8231870 TAGCCAGAGGCTCAGGGCGCAGG + Intronic
1144768497 17:17746028-17746050 TAGGCAGGGGCTGAGCCCAGAGG - Intronic
1144836579 17:18159519-18159541 CAGGGAGGGGCTCAGCCCTGGGG + Intronic
1145994786 17:29099059-29099081 GGGCCAGAGGAGCAGCCCTGGGG - Intronic
1146794925 17:35774159-35774181 AGGCCAGAGTCTCAGCCCTCAGG - Intronic
1147610035 17:41796426-41796448 TAGAGTGAGCCTCAGCCCTGGGG + Intergenic
1147741562 17:42673475-42673497 CAGGCAGAGGCTGAGCGCTGGGG - Exonic
1148781598 17:50125206-50125228 CAGACACAGGCTGAGCCCTGTGG + Intronic
1150314491 17:64156896-64156918 ATGCCAGAGGCTGAGCGCTGTGG + Intronic
1151309539 17:73285056-73285078 CAGCCAGCGGGTCAGCCCAGAGG - Exonic
1151674685 17:75591369-75591391 CAGCCAGGAGCTCGGCCCTGAGG - Intergenic
1151914862 17:77110470-77110492 TGGCCAGAGACACAGCCCTCAGG + Intronic
1152127170 17:78454223-78454245 GAGACGGAGGCTCAGGCCTGGGG - Intronic
1152267014 17:79301100-79301122 TAGCCAGAGGCTTCTCCCTGGGG - Intronic
1153018584 18:606500-606522 CAGCCAGAGTCTCAGAGCTGTGG - Intronic
1153066813 18:1055060-1055082 TTGCCAGAGGCTCAAGCATGAGG - Intergenic
1153624148 18:7007260-7007282 TACCCAGGGGCGCAGTCCTGAGG + Exonic
1153667910 18:7382797-7382819 AAGCCAGAGGCTGAGCCATGTGG + Intergenic
1159015913 18:63101563-63101585 TAGCCAGGGGCTCAGGCCCCAGG - Intergenic
1160146249 18:76367486-76367508 TGGGCAGAGGCTCGGGCCTGGGG - Intronic
1160703706 19:519518-519540 TAACCAGGCGCCCAGCCCTGCGG + Exonic
1160960825 19:1720087-1720109 AGGACAGAGGCTCAGCTCTGGGG - Intergenic
1160967436 19:1752909-1752931 TGGGCAGAGGCTGACCCCTGGGG + Exonic
1161340713 19:3740546-3740568 TGGCCAGCTGCTCCGCCCTGGGG - Exonic
1162591457 19:11595049-11595071 TAGCCAGGGGCTGAGCACAGTGG - Intronic
1162818010 19:13207783-13207805 CGGCCAGAGGCTCGGCCGTGGGG + Exonic
1162935707 19:13980488-13980510 AGGCCAGAGGCACAGCCGTGGGG + Intronic
1163375101 19:16925229-16925251 AACCCAGCAGCTCAGCCCTGAGG - Exonic
1164511173 19:28898460-28898482 TTGGCAGAGTCTCTGCCCTGCGG + Intergenic
1164591462 19:29509802-29509824 TAGCTGGAGCCCCAGCCCTGAGG - Intergenic
1165154087 19:33777074-33777096 CACCAAGGGGCTCAGCCCTGAGG - Intergenic
1166048487 19:40243599-40243621 TAACTAGAGGCTAAGCACTGTGG + Intronic
1167209090 19:48121989-48122011 CAGGCAGAAGCTCAGCCCTGGGG + Intronic
926478376 2:13357024-13357046 TGGCCTGAGACTCACCCCTGAGG - Intergenic
928294171 2:30068543-30068565 TAGGAAGAGGTCCAGCCCTGTGG + Intergenic
929563265 2:42968933-42968955 AAGGCAGTGGCTAAGCCCTGAGG + Intergenic
931641342 2:64383274-64383296 TAGGCAGAGGGGCAGACCTGGGG + Intergenic
932863381 2:75317138-75317160 TAGCCAGAGGCTGGACCCTGGGG + Intergenic
933159540 2:79008859-79008881 TAGCAAGAGGCAAAGCCCGGAGG + Intergenic
934501298 2:94862042-94862064 TGGCCAGAAGCTCTGGCCTGCGG - Intergenic
935921699 2:108022513-108022535 TACCCAGACTCTCATCCCTGAGG - Intergenic
936533260 2:113291400-113291422 GCGCCGGAGGCCCAGCCCTGCGG - Intergenic
937094037 2:119224236-119224258 TGGCCAGAGCCCCAGCCGTGGGG - Intronic
937344878 2:121119355-121119377 TAGGCATAGGCTGTGCCCTGGGG - Intergenic
938108660 2:128550082-128550104 CAGACAGAAGCTCAGCACTGAGG + Intergenic
938291148 2:130151272-130151294 AAGCCAGAGGTCCAGGCCTGTGG + Intergenic
938382296 2:130843473-130843495 TAGCAGGAGGCACAGCCCAGGGG - Intronic
938465397 2:131521687-131521709 AAGCCAGAGGCCCAGGCCTGTGG - Intergenic
938737834 2:134202586-134202608 CAGCCAGAGGCTGATGCCTGGGG - Intronic
938861761 2:135376668-135376690 TTACCAGGGGTTCAGCCCTGGGG + Intronic
941253716 2:163200822-163200844 TAGGCAGTGACTCAGCCATGTGG + Intergenic
942202224 2:173582841-173582863 TGGCCAGAGCCTCTGCCCTCTGG + Intergenic
944269070 2:197760520-197760542 CAGCCAGAGTAACAGCCCTGTGG + Intronic
945259333 2:207829801-207829823 AAGCCTGAGGCTGAGCCCTCGGG - Intronic
946203006 2:218082067-218082089 GAGCCAGAGGCTGGGCCCTGGGG + Intronic
946396584 2:219446416-219446438 TTCCCAGAGGCTCTTCCCTGGGG + Intronic
948217882 2:236245173-236245195 TGGGCAAAGGCTCAGCTCTGGGG + Intronic
948629772 2:239294634-239294656 TATCCTGAGCCTCAGCCATGAGG - Intronic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
948993422 2:241565666-241565688 TAGCCAAGGCCCCAGCCCTGAGG - Intronic
1168841675 20:913835-913857 CAGCCACAGGCTGTGCCCTGGGG - Intronic
1168959683 20:1860337-1860359 TAGACAGAGGATGTGCCCTGGGG - Intergenic
1169965654 20:11214603-11214625 TAACCAGAGGCTCAGCTCACTGG + Intergenic
1170180730 20:13527089-13527111 TCACCAAAGGCTCAACCCTGGGG + Intronic
1170578815 20:17682673-17682695 TATCCAGAGGCGCAGGCCCGGGG - Intergenic
1170658122 20:18309613-18309635 TAGCCAGAGGCTCAGCCCTGTGG + Intronic
1170830012 20:19832169-19832191 AAGCCAGTGGCTGAGCCCAGTGG + Intergenic
1171886354 20:30654708-30654730 TGGCCAGAGGTTAGGCCCTGGGG + Intergenic
1171986855 20:31666653-31666675 CAGCCAGAGGCTCCTCCCTCTGG + Intronic
1172174233 20:32962411-32962433 CAGTCCGAGGCTCAGCCCTGAGG + Intergenic
1172344211 20:34184421-34184443 CCGCCAAAGTCTCAGCCCTGTGG + Intergenic
1172388136 20:34548151-34548173 TAGCTAGAGGCACAGGCTTGGGG + Intronic
1172890382 20:38260200-38260222 GAGCCTGAATCTCAGCCCTGAGG - Intronic
1172913077 20:38424610-38424632 AAGACAGAGGCACTGCCCTGAGG + Intergenic
1172934875 20:38612957-38612979 CAGCCAGCAGCGCAGCCCTGTGG - Intronic
1173415278 20:42849583-42849605 TGGGCAGAGCATCAGCCCTGGGG + Intronic
1173570992 20:44075935-44075957 AAGTCAGAGCCTCAGCCCTGGGG + Intergenic
1174556217 20:51397453-51397475 AAGCCAGCGGCTCAGGCCTGTGG - Intronic
1174576664 20:51542312-51542334 CCGCCAGGGGCTCAGGCCTGGGG - Intronic
1175447761 20:59036149-59036171 TAGCCTGAGGCCCAGCACTGAGG - Intronic
1176674741 21:9767805-9767827 CAGACGGAGCCTCAGCCCTGCGG - Intergenic
1178271534 21:31194291-31194313 TGACCAGAGGCTGAGCTCTGTGG + Intronic
1178286870 21:31333187-31333209 TACCCAGATCCTCAGCCCTCGGG - Intronic
1179493544 21:41756976-41756998 TTTCCAGAGTCTCAGTCCTGAGG + Intronic
1179591648 21:42413095-42413117 GAGCCAGAGGCACGGCCGTGGGG - Exonic
1179813251 21:43885743-43885765 TGGCCCCAGGCCCAGCCCTGTGG + Intronic
1180951185 22:19721334-19721356 GAGACATAGGCTCAGCCCTGGGG + Intronic
1181030877 22:20148447-20148469 CAGCCACAGGCCCAGCCCTCAGG + Exonic
1181163246 22:20969757-20969779 TAGCCAGAGGCTCAGGCCCCAGG + Intronic
1181464015 22:23101242-23101264 GAGCCAGAGTCTCAGCCCTGCGG - Intronic
1181634369 22:24167562-24167584 TACCCAGAGGCCCAGCGCAGCGG - Intronic
1181637428 22:24180953-24180975 CAGACACAGGCTGAGCCCTGGGG - Intergenic
1181637618 22:24181667-24181689 TGGACAGAGGCTGAGCCCAGAGG - Intronic
1183087547 22:35495713-35495735 CAGCCAGAGGGTGATCCCTGGGG - Intergenic
1183122749 22:35742936-35742958 TAGCCACAGGCTCAAGACTGTGG + Intronic
1183745727 22:39690595-39690617 CAGCCAGAGGCTCGGCCCCTGGG + Intergenic
1184034593 22:41912467-41912489 TCCCCAGAGGCTCACCTCTGTGG + Intronic
1184427829 22:44423530-44423552 AAGCAAGAGGCTCAGCTGTGGGG + Intergenic
1185326597 22:50228670-50228692 TAGGCAGAGGCTCAGCCCCGGGG - Intronic
949095276 3:78246-78268 CAGCCAGAAGCTCAGGTCTGAGG - Intergenic
951139850 3:19147444-19147466 AAGCCTGCGGCACAGCCCTGTGG - Intergenic
951181824 3:19668348-19668370 TAGCCAGAGGGCCATCCCCGTGG + Intergenic
960581959 3:119288790-119288812 CAGCCAGAGTAACAGCCCTGTGG - Intergenic
961458260 3:127034763-127034785 CTCCCAGAGGCACAGCCCTGAGG - Exonic
961646843 3:128397271-128397293 TAGCCAGACTCTCAGGCCCGTGG + Intronic
962500621 3:135987918-135987940 TATCCAAAGGCTGAGCCATGGGG - Intronic
964809781 3:160651331-160651353 TACACAGAGGCTTGGCCCTGGGG + Intergenic
965583027 3:170289623-170289645 AAGCCAGAGGCTCGGCACAGTGG + Intronic
965609856 3:170532385-170532407 GAGCCAGGAGCTCAGCCCAGAGG - Intronic
966672032 3:182538011-182538033 TAGCCTCAGCCTTAGCCCTGTGG + Intergenic
966915168 3:184580660-184580682 CAGCCAGGGGCTCGGGCCTGGGG + Intronic
968132940 3:196202627-196202649 AGGCCAGAGGCTGAGCCCTGAGG + Intronic
968503510 4:961648-961670 TCCCCAGAGGCTCTGCCCGGCGG - Intronic
968982704 4:3859134-3859156 TAGGCACAGGCTAAGCACTGGGG + Intergenic
968982760 4:3859514-3859536 TAGGCACAGGCTAAGCACTGGGG + Intergenic
969893878 4:10284928-10284950 TAGCCATGGGCTCATCACTGAGG - Intergenic
974727779 4:65817960-65817982 TAGCCAGAAGTTCAACCCAGGGG - Intergenic
975716800 4:77212992-77213014 TAGCCAGAGGCTCAGATCTCAGG - Intronic
976322888 4:83735871-83735893 TATCCAGAGGCTCAAGGCTGAGG + Intergenic
979994149 4:127410396-127410418 TAGTGACAGTCTCAGCCCTGGGG - Intergenic
984173831 4:176391702-176391724 TAGGCAGAGGCTGGGTCCTGTGG + Intergenic
984528022 4:180880617-180880639 GAGCCACAGACTGAGCCCTGAGG + Intergenic
985541462 5:489397-489419 CAGCCCGAGCCTCAGCCCAGAGG - Intronic
985949991 5:3215610-3215632 CAGCCAGTGGCTCAGGCCAGGGG - Intergenic
987777991 5:22394538-22394560 TGGCCTGAGGCTCACTCCTGTGG - Intronic
989368292 5:40679977-40679999 CTGCCAGAGGCTCTGGCCTGGGG - Exonic
989974960 5:50573621-50573643 TAGCCTGTGGCTCAGAACTGTGG + Intergenic
991487454 5:67152312-67152334 CAGCCAGAGGCTAATCCTTGTGG + Intronic
991943802 5:71880789-71880811 AAGCGACAGGCTCAGCCCTTGGG - Intergenic
991957002 5:72004992-72005014 TAGCCGGAGCCTCAGAGCTGTGG - Intergenic
992078488 5:73213578-73213600 TAGTCTGAGGATCACCCCTGGGG + Intergenic
995824634 5:116281864-116281886 TAGCCTGAGGCTGAGCCATAAGG - Intronic
997643722 5:135466632-135466654 TCGTCTGAGGCACAGCCCTGCGG - Intergenic
998000487 5:138621258-138621280 GAGCCAGAGGCTCCTCCCTGGGG - Intronic
998497148 5:142600918-142600940 TAATCTGAGGCTCATCCCTGAGG - Intronic
999138127 5:149337133-149337155 TTGCCAGAGGCTGAGGGCTGGGG + Intronic
999942000 5:156553018-156553040 CAGCCTGAGGCTCATACCTGAGG - Intronic
1001413822 5:171529126-171529148 TTGGCAGTGGCTCAGCCCAGTGG + Intergenic
1001642561 5:173254932-173254954 CAGCCAGAGGGCCAGCCCCGGGG + Intergenic
1002915107 6:1522701-1522723 AAGACTGAGGCTAAGCCCTGTGG - Intergenic
1004053595 6:12112721-12112743 CATCCAGAAGCCCAGCCCTGTGG - Intronic
1009288473 6:61853055-61853077 TAGCCAGAAGCTCAGAGCTCAGG - Intronic
1011986753 6:93456938-93456960 TAGCCAGAGGCTCTGGAATGTGG + Intergenic
1013594313 6:111647018-111647040 GTGCCTGGGGCTCAGCCCTGGGG - Intergenic
1017876056 6:158525030-158525052 GAGGCAGAGGCTGAGCCATGGGG - Intergenic
1018583106 6:165324886-165324908 TGGCCTGTGGCTCAGTCCTGGGG - Intergenic
1018892349 6:167990823-167990845 GACCCTCAGGCTCAGCCCTGGGG + Intergenic
1019256885 7:58047-58069 GAGCCACAGGCTGAGGCCTGGGG + Intergenic
1019306916 7:339965-339987 TAGCCAGAGGCTGGGTCTTGGGG - Intergenic
1019959340 7:4445551-4445573 GCCCCAGAGGCTCAGCCCTGGGG + Intergenic
1020216309 7:6193610-6193632 AAGCCAGAGCCTAAGCCTTGTGG - Intronic
1021948531 7:25752344-25752366 TCTGCAGAGCCTCAGCCCTGAGG - Intergenic
1022301579 7:29107067-29107089 TCCACAGAGGCTCAGCCATGGGG + Intronic
1023485128 7:40678027-40678049 AAGCCAGCGGCTGTGCCCTGTGG - Intronic
1023681832 7:42695234-42695256 TTGACAGAGGCAGAGCCCTGGGG - Intergenic
1024089442 7:45922916-45922938 TAGCCACAGCCTGAGCACTGTGG - Intergenic
1027800601 7:82745054-82745076 TAGCCAAGGGATCACCCCTGGGG + Intergenic
1029383874 7:100231011-100231033 CAGCCACAGGCGCAGCACTGAGG - Intronic
1030358557 7:108570054-108570076 TCGCCAGCGCCTCAGCTCTGTGG + Exonic
1031025377 7:116673141-116673163 TAACCAGAGGCTGAGCGATGTGG + Intronic
1033162960 7:139013345-139013367 TGGCCAGTGGCACAGCCCTCGGG - Intergenic
1033576990 7:142695016-142695038 TATCCAGAGGCTTAGCTGTGAGG - Intergenic
1034411031 7:150942319-150942341 CAGCCAGGTGCCCAGCCCTGCGG + Intergenic
1034988375 7:155531870-155531892 TGGCCAGAGGCTCAGGGCTTAGG - Intronic
1035030238 7:155852184-155852206 TAAGCAGCAGCTCAGCCCTGGGG - Intergenic
1035477780 7:159155826-159155848 TAGCCAGGGGCTAGTCCCTGTGG + Intergenic
1035524607 8:302588-302610 AAGCCAGAGGGGCAGTCCTGGGG - Intergenic
1037902446 8:22695583-22695605 TAGCCAGCGGCTCTGGCCTCTGG + Intergenic
1038214980 8:25553458-25553480 TGGCCAGAGGCTCCACCCTCTGG - Intergenic
1040752488 8:50727763-50727785 TAGCCACAGGATCAGCTCTTGGG - Intronic
1045179270 8:99762413-99762435 CTGCCAGTGGGTCAGCCCTGTGG - Intronic
1048556705 8:135484789-135484811 CAGCCAGAGGCTCAGCCTGCAGG + Intronic
1049096477 8:140551268-140551290 CAGGCAGAGGCTCCGGCCTGGGG - Intronic
1049170860 8:141159838-141159860 TGGCCAAAGGCTCACCCCAGAGG - Intronic
1049248389 8:141575155-141575177 GACCCTGTGGCTCAGCCCTGTGG + Intergenic
1049282548 8:141757705-141757727 TCACCAGAGTCTCGGCCCTGCGG + Intergenic
1049675391 8:143886754-143886776 TACCCTGGGCCTCAGCCCTGTGG - Intergenic
1052416192 9:28181390-28181412 TAGGCAAAGGCTCAGGCCAGTGG + Intronic
1052890480 9:33694898-33694920 TATCCAGAGGCTTAGCTGTGAGG - Intergenic
1053266683 9:36720292-36720314 TAGCCAGAGCCTCTGCCCCTTGG + Intergenic
1054736711 9:68760138-68760160 TAGCTACAAGCTCAGCTCTGTGG + Intronic
1054953033 9:70874443-70874465 CAGCCATAGGCTTAGCCCAGTGG + Intronic
1056274754 9:84983286-84983308 TAGGCACAGGCTCTGTCCTGTGG + Intronic
1059461405 9:114432946-114432968 AAGCCAGAGGCAGGGCCCTGGGG - Intronic
1059467241 9:114476755-114476777 GAACCTGAGGCTCAGCGCTGTGG - Intronic
1060470376 9:123943281-123943303 TAGACAGAGGTGCAGACCTGGGG + Intergenic
1060744705 9:126123567-126123589 AAGGCAGGGGCTCAGTCCTGTGG + Intergenic
1061092358 9:128433833-128433855 TACGCAGTGGCACAGCCCTGGGG + Intronic
1061713735 9:132505520-132505542 TAGACATAGGGTCAGTCCTGGGG + Intronic
1062034467 9:134376785-134376807 CAGCCAGGGGCGCAGCCCTAGGG + Intronic
1062388289 9:136323776-136323798 CAGCGAGGTGCTCAGCCCTGGGG + Intergenic
1062560867 9:137141335-137141357 AAGCCAGCGGCTCAGCCCCCTGG - Intronic
1062625310 9:137439763-137439785 TACCTGGAGGCTCAGGCCTGGGG - Intronic
1187144962 X:16629075-16629097 TAGCCAGAGACTGAGAGCTGAGG + Intronic
1188695330 X:33183455-33183477 CAGCCAGAGGCGCAGCTGTGTGG - Intronic
1189239915 X:39517093-39517115 GAGCCCCAGCCTCAGCCCTGGGG + Intergenic
1190244657 X:48683428-48683450 TAGCCTGAGGCTGAGGCCCGAGG - Intronic
1191640456 X:63426030-63426052 TAGCCAGGGGCTTGGCCTTGGGG + Intergenic
1196263061 X:113608431-113608453 TCTCCAGAGGATCAGACCTGAGG + Intergenic
1199265124 X:145819725-145819747 GAGGCAGAGGGACAGCCCTGTGG - Exonic
1200058989 X:153475753-153475775 CAGCCAGAGACACAGCCTTGGGG - Intronic
1200880306 Y:8205663-8205685 GAGCCAGAGGGTCAGTCCAGGGG + Intergenic