ID: 1170665741

View in Genome Browser
Species Human (GRCh38)
Location 20:18384649-18384671
Sequence GGACCAGGAGGGGCCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 8, 3: 67, 4: 526}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170665741_1170665749 4 Left 1170665741 20:18384649-18384671 CCAGGCTGGGCCCCTCCTGGTCC 0: 1
1: 0
2: 8
3: 67
4: 526
Right 1170665749 20:18384676-18384698 TCCCCAAACCTCTCCCCAAGAGG 0: 1
1: 1
2: 0
3: 17
4: 233
1170665741_1170665757 29 Left 1170665741 20:18384649-18384671 CCAGGCTGGGCCCCTCCTGGTCC 0: 1
1: 0
2: 8
3: 67
4: 526
Right 1170665757 20:18384701-18384723 ACAGTGACTTCAGTTCTCAGAGG 0: 1
1: 0
2: 0
3: 21
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170665741 Original CRISPR GGACCAGGAGGGGCCCAGCC TGG (reversed) Intronic
900147310 1:1163877-1163899 GGTACAGGTGGGGCTCAGCCCGG + Intergenic
900150419 1:1176579-1176601 GGCCCAGGAGGCTCCCAGCCGGG - Intronic
900329609 1:2127473-2127495 GGGGCGGGACGGGCCCAGCCAGG - Intronic
900367524 1:2317356-2317378 GGAACAGGAGGGGCACAGGGAGG + Intergenic
900396369 1:2454741-2454763 GGACACCGAGGGGCCGAGCCAGG - Intronic
900428651 1:2591973-2591995 GGACCAGCAGCTGCCCGGCCTGG - Exonic
900509132 1:3050132-3050154 AGTCCAGGAAGGACCCAGCCAGG + Intergenic
900552464 1:3263672-3263694 GGGCCTGGAGGAGCCCAGTCAGG - Intronic
900624527 1:3602195-3602217 GGAGGAGGAGGGGCCCAGCCCGG - Intronic
900765468 1:4502091-4502113 GGACAAGGAGGGTGCCAGGCAGG - Intergenic
900902397 1:5526132-5526154 GGAGCCGGAGGGTCCCAGGCAGG - Intergenic
901023549 1:6267303-6267325 GGACCAGGAGGGGCCAAGAGAGG + Intronic
901228643 1:7629795-7629817 GGACCAGAAAGGGCCCAGCCTGG - Intronic
901425884 1:9182310-9182332 GGACCAGGTGGGGGCCAGGCAGG + Intergenic
901473488 1:9473446-9473468 GGCCCTGGAGGGGACCATCCCGG - Intergenic
901643829 1:10706241-10706263 TGGGCAGGAGGGCCCCAGCCTGG - Intronic
901704056 1:11060208-11060230 GGGCCACGTGGGGCCCGGCCGGG + Intergenic
901741188 1:11343037-11343059 GGAGCAGGAGGGGAGGAGCCAGG + Intergenic
901769388 1:11522716-11522738 GGCCCAGCCAGGGCCCAGCCAGG + Intronic
901769393 1:11522727-11522749 GGCCCAGCCAGGGCCCAGCCAGG + Intronic
901828093 1:11875558-11875580 GGAACAGGAGGGGACTGGCCAGG - Intergenic
901830442 1:11888899-11888921 GGCCCAGGAAGGACCCACCCTGG - Intergenic
902250696 1:15153018-15153040 GGCCCAGGTGGGGCCCATTCCGG - Intronic
902388204 1:16088115-16088137 CTCCCAGGAGGTGCCCAGCCCGG - Intergenic
903006904 1:20304604-20304626 GGACCAGAAGGGAAACAGCCTGG + Intronic
903162181 1:21497057-21497079 GGACCAGGAGTGGACCAAGCTGG + Intergenic
903324167 1:22560323-22560345 GGACCCAGCGGGACCCAGCCAGG + Intergenic
903438191 1:23368270-23368292 GGCGCGGGAGGGACCCAGCCAGG - Intronic
903448615 1:23437794-23437816 AGACCAGGAAGGGCCCAGTGGGG - Intronic
903758992 1:25684705-25684727 GCACCAGGAGTGGCCGAGCATGG + Intronic
903840244 1:26233906-26233928 AGACCTGGAGGGGCCCTGCTGGG - Intergenic
904208233 1:28868924-28868946 GACCCAGCAGGTGCCCAGCCTGG - Intergenic
904364104 1:29999632-29999654 GGTCAAGGAGGGGCCAAGGCTGG - Intergenic
904614186 1:31741230-31741252 AGACAAGGAGAGGCACAGCCAGG + Intronic
904673092 1:32180432-32180454 AGCCCAGGAGCGGCCCAGCCAGG + Exonic
905201873 1:36321441-36321463 CGGGCAGGAGGGGCCCAGGCGGG + Intronic
905205904 1:36342753-36342775 GGACCAGGAGGGGCCGTGCCTGG - Intronic
905224676 1:36471559-36471581 GGGGCAGGATGGCCCCAGCCTGG + Exonic
905370948 1:37482458-37482480 GGGCCGGCACGGGCCCAGCCTGG + Exonic
905449106 1:38045987-38046009 GGACGAGGATGCGCCCAGCTCGG - Exonic
905542674 1:38772710-38772732 GGAGCATTAGGGGACCAGCCAGG - Intergenic
906062565 1:42958256-42958278 GCACCGGGAGGGGCCGAGGCTGG + Intronic
907513376 1:54978813-54978835 GGACCAGAAGGGGCTGGGCCTGG - Intergenic
908211321 1:61903247-61903269 GGACCAGGAGGAGAGCAGTCAGG + Intronic
911157957 1:94655162-94655184 GGAGCTGGAGGGACGCAGCCTGG - Intergenic
912454436 1:109788309-109788331 CGCCCTGGTGGGGCCCAGCCCGG + Intergenic
913519457 1:119631596-119631618 GGCCCAGGCGGGGCCCAAGCGGG - Intronic
914755873 1:150561382-150561404 GGAGGAGGAGGAGCCCGGCCCGG + Intergenic
915117490 1:153609835-153609857 GGACCAGGAGGGAACAGGCCAGG + Intronic
915319078 1:155046329-155046351 GGAGCAGGAGGGGCAGAGCTGGG - Intronic
915512242 1:156392694-156392716 GGGCCAGGAGTGCCCCAGCTGGG + Intergenic
915580386 1:156809576-156809598 GGAGGAGGAGGGGCCTAGCGGGG - Intronic
915954322 1:160209923-160209945 GGCCCAGCAGTGGCCCTGCCAGG - Intronic
916379082 1:164188689-164188711 GGAGCAGGAGGGGGCCTGCAGGG - Intergenic
916792601 1:168136970-168136992 GGGGCCGGAGGGGCCCGGCCGGG - Intronic
917235073 1:172883231-172883253 GGACCTGGAGGAGCCAAGCTAGG + Intergenic
918014123 1:180616483-180616505 GGATTATGAGGGACCCAGCCTGG + Intergenic
918104478 1:181404796-181404818 TGACCAGAAGGGGCCAGGCCTGG + Intergenic
919802245 1:201360953-201360975 GGACCAGGATGCACCAAGCCAGG - Intronic
919822698 1:201482997-201483019 GGACTTGGAGGGGCTCAGCTAGG - Intergenic
920216295 1:204363450-204363472 GGAGCCGCAGGGGCCCAGCTTGG + Intronic
920370033 1:205473065-205473087 GGAGGAGGAGGGGCACAACCCGG - Intergenic
920370775 1:205477922-205477944 GGACCAAGGGAGGCCCAGTCAGG - Intergenic
922200224 1:223394528-223394550 GGACCAGGAGAGCCCGCGCCAGG + Exonic
922553959 1:226519047-226519069 GGTCCAGGATGGGCCCAGAGTGG + Intergenic
923722924 1:236482598-236482620 GGACGAGGAGTGGCCCAAGCGGG + Exonic
924038299 1:239957859-239957881 GGAGCAGGAGGGGCTCAGCAGGG - Intergenic
924584648 1:245351245-245351267 GGACCAAAAAGGGCCCACCCAGG - Intronic
1062932466 10:1362501-1362523 GGAACCGGAGGGGTCCTGCCGGG + Intronic
1065170538 10:23022849-23022871 AGACCAGGATGTGGCCAGCCTGG + Intronic
1065198619 10:23291655-23291677 GGACCAGGACGGGCAGCGCCAGG + Intronic
1065596673 10:27319879-27319901 GGGCGAGGGGAGGCCCAGCCCGG + Intergenic
1065966338 10:30774180-30774202 GGACCAGGAGCTGCCCAAGCGGG + Intergenic
1067095519 10:43296944-43296966 GGCCCAGGAGAAGACCAGCCTGG + Intergenic
1067278095 10:44852000-44852022 GGCCCAGGATGGGCCCAGGATGG + Intergenic
1067528028 10:47050064-47050086 GGGCCTCGAGGGGCCCAGGCAGG - Intergenic
1069667221 10:70170662-70170684 GGAGCAGGCGGGGCCGAGGCGGG - Intergenic
1069719485 10:70540603-70540625 GCGCCAGGAGGGGCTCAGGCAGG - Intronic
1069856372 10:71443292-71443314 GGATCAGGGTGGGCCAAGCCAGG - Intronic
1070032786 10:72692796-72692818 GGACGAGGGGCGGCCCCGCCGGG - Intronic
1070565339 10:77599844-77599866 GGACCATCAGGGGCTCAGGCTGG - Intronic
1070680599 10:78446367-78446389 GGAGCAGGATGGGCAGAGCCAGG + Intergenic
1070720321 10:78752468-78752490 TGACCAGGAGGAGCCGGGCCAGG + Intergenic
1070763868 10:79045189-79045211 GGACCAGGAGGAGGGCAGCTTGG + Intergenic
1070805856 10:79270300-79270322 GGATCAGAAGGGGACCAGGCAGG - Intronic
1073327347 10:102650494-102650516 GGACTAGGTGGGGCCCAGGGAGG - Intronic
1074312039 10:112330318-112330340 GGACCGGGAGGGGCCTGGCTGGG + Intergenic
1074329354 10:112489113-112489135 GGCCCAGGTGGGGCCGAGACAGG + Intronic
1074535976 10:114328919-114328941 AGACCAGGTGGGACCTAGCCAGG + Intronic
1074768219 10:116716175-116716197 AGACATGGAGGGGCCCAGCAGGG - Intronic
1075845849 10:125544563-125544585 GCAGCAGGAGGTGCACAGCCAGG - Intergenic
1076187962 10:128463715-128463737 GGACCAGGAGGCACAAAGCCAGG + Intergenic
1076337817 10:129720374-129720396 GAGCCAGGAGGGGCCGAGGCTGG - Intronic
1076854049 10:133106566-133106588 TGCCCAGGATGGGCACAGCCTGG + Intronic
1077333043 11:1991704-1991726 GGCCGAGGAGGGCCCCCGCCCGG + Intergenic
1077418034 11:2434800-2434822 GGGCCAGGAGGACCACAGCCTGG + Intergenic
1077635817 11:3840878-3840900 GCACCAGGTGAGGCCCGGCCGGG - Exonic
1078296496 11:10076516-10076538 GGACCAGGAGGGGTGTGGCCTGG + Intronic
1078631800 11:13010053-13010075 GGCCCCGGCGCGGCCCAGCCTGG + Intergenic
1078662278 11:13297192-13297214 GGAGCAGCAGGGCTCCAGCCAGG - Intronic
1081406720 11:42707133-42707155 GGACCAGGAGGTGCTCAGAGAGG - Intergenic
1081847602 11:46251987-46252009 GTACCAGGCAGGGCCCAGACAGG - Intergenic
1083198154 11:61103173-61103195 AGTCCCAGAGGGGCCCAGCCAGG + Intronic
1083319613 11:61837852-61837874 GGCCCCGGAGGAGCCCAGCCAGG + Exonic
1083679467 11:64344524-64344546 GGAGCAGGAGGGCCCAAACCAGG + Exonic
1083765943 11:64841749-64841771 GGACCGGGGTGAGCCCAGCCCGG + Intronic
1083844208 11:65321555-65321577 GTCCCAGGTGGGGCCCAGCCAGG + Exonic
1083861695 11:65423413-65423435 GGCCCAGGCCGGGCCCAGCCTGG + Intergenic
1083895636 11:65618481-65618503 CGACCAGGAGCGGCTCAGCCAGG - Exonic
1083949590 11:65946761-65946783 GGGCCCAGAGGGACCCAGCCAGG + Intronic
1084106997 11:66986698-66986720 GGACCAGGAAGGGCCTGGCGTGG + Intergenic
1084755508 11:71236010-71236032 GGACCAGGAGGAAGCCAGGCTGG + Intronic
1084943988 11:72629172-72629194 GGAGCAGGTGGGGCCGACCCAGG + Intronic
1084978220 11:72814748-72814770 GGACCAGGAGGGGCTCGTCCAGG - Intronic
1085011790 11:73146474-73146496 GGACTTGGTGGGGCCCAGGCAGG - Intergenic
1085023485 11:73223284-73223306 GGAGCAGGAAGGGTCCAGCTTGG - Intronic
1085308386 11:75501220-75501242 GTGCGAGGAGGGGCCGAGCCAGG - Intronic
1085472595 11:76767797-76767819 GCCCCAGGAGGGGCCCAGGAAGG - Intergenic
1085534951 11:77212125-77212147 GGACCAGAAGAAGCTCAGCCTGG + Intronic
1085706683 11:78792621-78792643 GCACCAGGTGTGGCCCAGCATGG + Intronic
1085759815 11:79232386-79232408 GGAAAAGGAGGGGCACAGGCTGG - Intronic
1087120433 11:94568854-94568876 GGAGCAAGAGGAGCCCTGCCAGG + Intronic
1089333218 11:117704535-117704557 GGACCATCATGGGCCAAGCCTGG + Intronic
1089349759 11:117815714-117815736 GGAACAGTGGAGGCCCAGCCTGG - Intronic
1089592835 11:119555702-119555724 GAACCAGCAGGGGCCCAGGAGGG - Intergenic
1090869104 11:130726972-130726994 GGAGCAGGTGGGGCCTAACCTGG + Intergenic
1091023621 11:132123016-132123038 GTGCCAGGAGGAGGCCAGCCAGG - Intronic
1091221421 11:133931852-133931874 GGCCCAGCTGGGACCCAGCCTGG - Intronic
1202816026 11_KI270721v1_random:46882-46904 GGCCGAGGAGGGCCCCCGCCCGG + Intergenic
1093662589 12:21774636-21774658 GGACCAGGGGCCGCCCAGGCCGG + Exonic
1096217189 12:49804196-49804218 TGACCAGGAGATACCCAGCCTGG - Intronic
1100391630 12:94149595-94149617 GGACACGGAGGGGCGCAGCCTGG + Exonic
1100435654 12:94569212-94569234 ATACCAAGAGGGGCCCACCCAGG + Exonic
1101259363 12:103013121-103013143 AGAAGAGGAGGGGCCCAGCCGGG - Intergenic
1101631364 12:106498257-106498279 GGAACAGGAAGAGGCCAGCCTGG + Intronic
1102164795 12:110797597-110797619 GGGCCTGGAGGGGCCCTGACTGG + Intergenic
1103392454 12:120584539-120584561 GGGCCAGAAGGGGCCGGGCCTGG - Intergenic
1103700740 12:122847618-122847640 AGGCCAGGTGGGCCCCAGCCGGG + Intronic
1103825190 12:123732313-123732335 GCAGGAGCAGGGGCCCAGCCAGG - Intronic
1104071982 12:125353752-125353774 AGACAAGGAGGGGCCCAGTCAGG + Intronic
1104505502 12:129328078-129328100 GCTCCAGGAAGGGCCCAGCCTGG - Intronic
1104758683 12:131284262-131284284 AGAACAGGTGGGGCCCAGACTGG - Intergenic
1104821918 12:131682263-131682285 AGAACAGGTGGGGCCCAGACTGG + Intergenic
1104821947 12:131682334-131682356 GGAAGAGGTGGGGCCCAGACTGG + Intergenic
1104821975 12:131682405-131682427 GGAAGAGGTGGGGCCCAGACTGG + Intergenic
1104981688 12:132575835-132575857 GGACCAGGAGGGGCCGGCCCAGG + Intronic
1105213909 13:18273525-18273547 GGAGCAGGGGGCACCCAGCCAGG + Intergenic
1105426978 13:20302354-20302376 GGCCCAGGAGGAGCCCTCCCGGG - Intergenic
1105883714 13:24624889-24624911 GCACCAGGCCTGGCCCAGCCAGG + Intergenic
1105943464 13:25170860-25170882 CGAGCCGGAGGAGCCCAGCCAGG - Exonic
1106248669 13:27968326-27968348 GCGCCAGGAGGGGCACGGCCCGG - Intronic
1106555601 13:30805755-30805777 GCCCCAGGCTGGGCCCAGCCAGG - Intergenic
1108518293 13:51222633-51222655 GGATCAGGAGGGTCCCCGTCCGG - Intronic
1109164334 13:59015127-59015149 GGAGCAGTAGGGGCAGAGCCAGG - Intergenic
1110163426 13:72407508-72407530 TGACCAGGATTGGCCCATCCTGG + Intergenic
1113292181 13:108919245-108919267 GGGGCAGGAAGGGCCCAGCCAGG - Intronic
1113633177 13:111901773-111901795 AGATCAGGAGGGTCCCAACCTGG + Intergenic
1115119818 14:29926929-29926951 GGACAAGGAGGGGCGCGGCGAGG + Intronic
1117082392 14:52165661-52165683 ACACCATGAGGGGCCCATCCTGG + Intergenic
1117131975 14:52695751-52695773 GGACCGGGCGGGGCCGAGCCGGG - Intronic
1118555474 14:67014888-67014910 GTACCAAGAGGAGACCAGCCTGG + Intronic
1119319072 14:73718811-73718833 GGCCCAGGACTGGGCCAGCCTGG + Exonic
1120623741 14:86798363-86798385 GGACCAGGAGGGAGCAAGCCAGG + Intergenic
1121584161 14:95051474-95051496 AGCCTAGGAGGGGCTCAGCCAGG - Intergenic
1122420752 14:101575630-101575652 TGACCAGCAGGAGCCCAGGCAGG + Intergenic
1122836754 14:104434384-104434406 GGAGCAGGTGGGGACCAGCATGG + Intergenic
1122875199 14:104660671-104660693 GGACCGAGAGGGGCCCTGGCAGG + Intergenic
1122937393 14:104966510-104966532 GGAGCAGCAGGGGCCCTGTCAGG - Intronic
1123029771 14:105446200-105446222 GGTGCAGGTGGGGCCCAGCTCGG - Intronic
1123072853 14:105650457-105650479 GGAACAGGAAGCGTCCAGCCTGG + Intergenic
1124248982 15:28095249-28095271 AGGGCAGGAGTGGCCCAGCCAGG + Intronic
1124720947 15:32110329-32110351 GGGACAGGAGGGGCACACCCAGG - Intronic
1125677310 15:41509340-41509362 GGGACAGGAGGGGCTCAGGCAGG - Intronic
1125728037 15:41878063-41878085 CCACCTGGAGGGGGCCAGCCGGG + Intronic
1126341171 15:47642624-47642646 AGACCTGGAGTGGCCCAGCCGGG + Intronic
1126449378 15:48789167-48789189 GGGCCTGGAGGGTCCCAGCTAGG - Intronic
1127771107 15:62231542-62231564 GTACCAGGAGAGGCCATGCCTGG - Intergenic
1127774327 15:62253616-62253638 TGCCCAGGAGGGGCCCAGTTAGG - Intergenic
1128474777 15:67987897-67987919 GGAGCAGGGGGTGGCCAGCCAGG + Intergenic
1129255754 15:74333119-74333141 GGTCCAGGTGGAGGCCAGCCAGG - Intronic
1129319680 15:74767682-74767704 GGACTAGGAGGGGACTGGCCTGG - Intergenic
1129393805 15:75233681-75233703 GGTCCAGGTGGGGCCCTGCCTGG + Intergenic
1129705564 15:77792217-77792239 GGACTGGGAGAGGGCCAGCCTGG - Intronic
1129876647 15:78979738-78979760 GCACCAGGACTGGCCCAGGCTGG - Intronic
1129949308 15:79571968-79571990 GGGACACGAGGGTCCCAGCCAGG - Intergenic
1130093231 15:80838290-80838312 GGGCCAGCAGGGTCCCTGCCAGG - Intronic
1130663477 15:85850108-85850130 GGAAGAGGAGGGGCCCAGGAGGG - Intergenic
1131122868 15:89833936-89833958 GGCCCAAGAGGGGCCCAGGCTGG + Exonic
1131152993 15:90058561-90058583 GGAACAGAGGGGGCCCAGCACGG - Intronic
1132341333 15:101080148-101080170 GGACTAGGAGGGCCCCCGCCAGG + Intergenic
1132462224 16:61326-61348 GGACCTGGAGGTGCCCGGCGGGG - Intronic
1132544550 16:527357-527379 GGACACGGACGGCCCCAGCCCGG + Intergenic
1132603845 16:785534-785556 GGCCCAGGAGCAGCCCATCCTGG + Exonic
1132713418 16:1279104-1279126 GGAGCAGGAGGGGCTCAGCAGGG + Intergenic
1132737607 16:1394694-1394716 GGAGCAGGAGGGGCTGGGCCAGG - Intronic
1132891798 16:2208353-2208375 GGCCCGGGAGGGGACCTGCCTGG + Intronic
1133025157 16:2985990-2986012 GGACCAGGCTGGACCCAGTCGGG - Intergenic
1133054646 16:3139507-3139529 TGACGAGCAGGGGCCCAGGCTGG - Intronic
1133236610 16:4390195-4390217 GACCCAGGAGAGCCCCAGCCTGG + Intronic
1135161909 16:20103986-20104008 GGTCCAGGAAGGGCCCATTCAGG + Intergenic
1137774269 16:51042442-51042464 GTCCCTGGATGGGCCCAGCCTGG + Intergenic
1137774271 16:51042445-51042467 GCACCAGGCTGGGCCCATCCAGG - Intergenic
1138457868 16:57131713-57131735 GGGCCAGGAGGGGCCAGGCCTGG - Intronic
1138534516 16:57652893-57652915 GGAGCAGAGAGGGCCCAGCCAGG - Intronic
1138551214 16:57749722-57749744 TGGCCAGGAGCGGCCCAGCCTGG - Intronic
1139493775 16:67301516-67301538 GGATCAGGAGGAGCCCAGCCTGG - Intronic
1139551364 16:67674865-67674887 GGACCAGGAAAGGCTCACCCTGG - Exonic
1139963972 16:70735218-70735240 GGACCAGAAAGGGGCCAGCCTGG - Intronic
1141566121 16:84903224-84903246 GGTCCAGGAAGGGGCCAGGCTGG - Intronic
1141852167 16:86653882-86653904 GGACCAGGAGGAAACCAGCAGGG - Intergenic
1142177341 16:88651200-88651222 GGCATAGGAGGGGCCCTGCCCGG + Intergenic
1142197122 16:88744114-88744136 GCAGCAGGAGGGCACCAGCCAGG + Intronic
1142235064 16:88918263-88918285 GGATCAGGGAGGGCCCAGCTTGG - Intronic
1142315764 16:89344040-89344062 GGAGCAGGAGGGGCGGGGCCGGG - Intronic
1142393187 16:89816177-89816199 GGCCCAGGAGGGCCCGAGGCAGG + Intronic
1142434445 16:90047675-90047697 CCACCAGGAGGGCCCCAGCGGGG + Intergenic
1143719426 17:8799316-8799338 GGACCGAAAGGGGCCCCGCCCGG + Exonic
1144950118 17:18989421-18989443 GGCCCAGGAGGAGCCCAGATGGG - Intronic
1145247941 17:21282152-21282174 GGACCAGGTGAGGGCCAGACTGG - Intergenic
1145268618 17:21392532-21392554 GGACCAGCAGGAGCCCCACCAGG + Intronic
1145297414 17:21602231-21602253 GGACTAGGAGGGTCCCTGTCTGG - Intergenic
1145909627 17:28534949-28534971 GGTCCAGGAGGGGCCAGGCCTGG - Exonic
1145999322 17:29121877-29121899 GGACCACGATGGGGCCATCCTGG - Exonic
1146439012 17:32877211-32877233 GGGCCGGGAGGGGCGGAGCCGGG - Intergenic
1146656081 17:34636090-34636112 GGCCCAGGTGGTGGCCAGCCTGG + Exonic
1147123441 17:38350183-38350205 GGAGGAGGAAGGGCCCAGGCAGG + Intergenic
1148035105 17:44654542-44654564 AGCCCAGGAGTTGCCCAGCCAGG - Intergenic
1148114811 17:45169401-45169423 GGACCCGGAGGAGCCCAACTTGG + Exonic
1148197189 17:45722418-45722440 GGGCCAGGAAGAGCCCAGCTGGG - Intergenic
1148740771 17:49891061-49891083 GGAAGAGGAGGAGGCCAGCCTGG - Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1150280554 17:63927702-63927724 GGGCCAGGCTGGGCCAAGCCAGG - Intergenic
1150410933 17:64940144-64940166 TGACCAGGAGGGTCCCAGGTGGG - Intergenic
1150570780 17:66385136-66385158 GGACCAGGACGGTCCCTGGCAGG + Intronic
1151318273 17:73337213-73337235 TGGCCAGGCGGAGCCCAGCCTGG + Exonic
1151429512 17:74052961-74052983 GAACCAGGCAGGTCCCAGCCCGG - Intergenic
1151540629 17:74763058-74763080 GGCCGGGGTGGGGCCCAGCCTGG - Intronic
1151882963 17:76905892-76905914 GCACCTGCTGGGGCCCAGCCTGG + Intronic
1151944778 17:77313562-77313584 GGGCCAGGCTGGGGCCAGCCTGG + Intronic
1151965245 17:77427784-77427806 GGAACAGGAGGAGACCAGGCCGG + Intronic
1152504425 17:80738177-80738199 GCAGCAGGAGATGCCCAGCCCGG + Intronic
1152516265 17:80826610-80826632 GGACCAGGAGGAGGCCAGGGCGG - Intronic
1152615227 17:81334743-81334765 GAACAAGGAGGGAGCCAGCCAGG + Intergenic
1152640912 17:81448854-81448876 GGTCCAGGTGGAGCCCACCCTGG - Intronic
1152648299 17:81480436-81480458 GCAAGAGGCGGGGCCCAGCCTGG + Intergenic
1152755953 17:82087134-82087156 GGAGCAGCAGGTGCCCATCCTGG - Exonic
1154047093 18:10916315-10916337 GGACCAGGAGCCGCCTAGCAGGG + Intronic
1154169237 18:12038681-12038703 GGAGCAGGATGGGCCCGGGCTGG + Intergenic
1154194390 18:12254881-12254903 CTTCCAGGAGGGGCCAAGCCTGG - Intronic
1154412927 18:14151040-14151062 GGACACGGAGGGACCCAGCCTGG - Intergenic
1155158402 18:23176954-23176976 GAACCAGCAGGGGCTCAGGCGGG - Intronic
1157102658 18:44744381-44744403 GTACCCTGAGGGGCCCTGCCTGG + Intronic
1157425660 18:47582296-47582318 GGCCTCGAAGGGGCCCAGCCTGG + Intergenic
1157528308 18:48401773-48401795 GAAACAGGAGGGACCCAGGCGGG - Intronic
1160679988 19:408140-408162 CGACGTGGAGGGGCCCAGCGCGG + Exonic
1160741543 19:688517-688539 CGAGCAGGAGGGGGCCAGGCGGG + Intronic
1160955218 19:1688187-1688209 GGCCAAGGTGGGGCCCAGGCAGG + Intergenic
1161014894 19:1978660-1978682 GGAGCTGCTGGGGCCCAGCCTGG + Exonic
1161060834 19:2214017-2214039 GGAACCAGAGGGGCCCTGCCTGG + Intronic
1161065576 19:2235870-2235892 GGCCTCCGAGGGGCCCAGCCTGG + Intronic
1161072912 19:2271245-2271267 GGACCGGGTGGGCCCCTGCCTGG + Intronic
1161275306 19:3412995-3413017 GGGGCTGGAAGGGCCCAGCCTGG + Intronic
1161284164 19:3460189-3460211 GGAGCAAGAGGGGGCCATCCGGG + Intronic
1161361414 19:3852152-3852174 GGCCCAGGCGGGGCTCAGCTGGG + Intronic
1161505985 19:4643723-4643745 AGCCCAGGAGGAGACCAGCCTGG + Intronic
1161560955 19:4972142-4972164 AGAAGAGCAGGGGCCCAGCCTGG + Intronic
1161579577 19:5073429-5073451 GCACCAGGAGGGGCCCGCCTGGG - Intronic
1161579903 19:5075098-5075120 GGACCAGGAGGGGCACTCCCGGG - Intronic
1161590805 19:5128349-5128371 GGCCCAGGAGGGCCCCACCTGGG - Intronic
1161605820 19:5214345-5214367 GCACAAGGTGGGGCCCAGGCTGG - Exonic
1161666174 19:5578345-5578367 GCGGCAGGAGGGGCCCAACCGGG + Intergenic
1162028320 19:7906407-7906429 GGCCCTGCAGGGGGCCAGCCTGG + Intronic
1162028885 19:7909029-7909051 GGACCAGGTGGGGCCAATGCTGG - Intronic
1162300685 19:9843154-9843176 GGGCCTGGAGGGTCCCAGCAAGG + Intronic
1162453174 19:10766845-10766867 GGACTCTGAGGGACCCAGCCTGG - Intronic
1162817811 19:13207194-13207216 GGCCCGGGAGAGGGCCAGCCGGG - Exonic
1163031921 19:14550415-14550437 GGAGCAGGAGGAGCTCATCCGGG - Intronic
1163288621 19:16364583-16364605 GGACCAGGAGTGGCCCTGCATGG - Intronic
1163554204 19:17983308-17983330 GGGCAAGCAGGGGTCCAGCCAGG - Intronic
1163737093 19:18988201-18988223 GTTCCCTGAGGGGCCCAGCCAGG - Intergenic
1164261983 19:23576029-23576051 ACACCATGAGGGGCCCATCCTGG - Intronic
1164674885 19:30094477-30094499 GGACCACAATGGGCTCAGCCAGG - Intergenic
1164698127 19:30262223-30262245 GGACAATGAGGAGACCAGCCAGG - Intronic
1165322884 19:35097022-35097044 GGACCAGGAAGGGCCCGGGTTGG + Intergenic
1165398128 19:35578651-35578673 GGTCCTGGTGGGGCCCAGGCAGG - Intergenic
1165448185 19:35868354-35868376 GCCCCATGAAGGGCCCAGCCAGG - Intronic
1166084383 19:40465499-40465521 GGGCCATGAGCGCCCCAGCCAGG - Intronic
1166283645 19:41810642-41810664 GGTGCAGGGTGGGCCCAGCCAGG + Intronic
1166410691 19:42554054-42554076 GGTGCAGGGTGGGCCCAGCCAGG - Intronic
1166652652 19:44586197-44586219 GGACCAGAGGCAGCCCAGCCAGG - Intergenic
1166700549 19:44879309-44879331 GGGACAGCAGGGGCTCAGCCAGG + Intronic
1167032924 19:46975403-46975425 GCACCAGGGAGGGCCCAGCCTGG + Intronic
1167240365 19:48339668-48339690 AGCGCAGGAGGGGACCAGCCAGG + Intronic
1167289294 19:48615622-48615644 CCACCTGGAGGGTCCCAGCCTGG + Intronic
1167503565 19:49860288-49860310 ACTCCTGGAGGGGCCCAGCCCGG - Exonic
1167712916 19:51123378-51123400 TGAGCAGGAGGGGCTCAGTCAGG - Intergenic
1167715241 19:51138626-51138648 TGAGCAGGAGGGGCTCAGTCAGG - Intergenic
1167786653 19:51643341-51643363 TGAGCGGGAGGGGCTCAGCCAGG + Exonic
1168011529 19:53537529-53537551 GGACCAGGAAGGGCTTAGCTTGG + Intronic
1168094480 19:54106860-54106882 GGACCCTCAGGGCCCCAGCCTGG + Exonic
1168199580 19:54805089-54805111 GGACAAGGAGAAGCCCAGACAGG - Intronic
1168411000 19:56140568-56140590 GGCTCAGGAGGGGGCCAGCGCGG - Intronic
1168461990 19:56567319-56567341 GGACCAGGAGAGGCCCAAAAGGG + Intergenic
1168469753 19:56630462-56630484 GGATCAGGAGGGGCGCTGGCCGG + Intergenic
925042161 2:740395-740417 GGAGGGGGCGGGGCCCAGCCAGG + Intergenic
927553272 2:24016776-24016798 GGAACACAAAGGGCCCAGCCTGG - Intronic
927651092 2:24914163-24914185 GGATCAGGAGGAGCCGAGGCTGG - Intronic
927893302 2:26765689-26765711 GGAACAGGTGGGGCCCACCCAGG - Intronic
927969754 2:27298173-27298195 GGCCCAAGAGGGCCCCAGACTGG + Intronic
928096695 2:28409277-28409299 CCATCAGGAGTGGCCCAGCCTGG + Intronic
929503250 2:42508077-42508099 GGAACAGCAGGTGCCCAGCCTGG - Intronic
930035635 2:47083598-47083620 AGAGCAGGAGGGGCCAAGGCTGG - Intronic
931198799 2:60077356-60077378 GTAGCAGGAGGGTCCCAGACAGG + Intergenic
931257203 2:60584088-60584110 TGAACAGGAGGGGCCTGGCCGGG + Intergenic
931377008 2:61717017-61717039 GGACTATGAGTGGCCCAGCCTGG + Intergenic
932887228 2:75559391-75559413 GGTACAGGAAGGCCCCAGCCAGG + Intronic
933948617 2:87309088-87309110 GTCCCAGGAGAGGCCCACCCAGG - Intergenic
933986257 2:87594682-87594704 GGACCCTGAGAGGCCCAGCCTGG - Intergenic
934079190 2:88452730-88452752 GGCCCAGGAGGAGCCGCGCCGGG - Intergenic
934849769 2:97690669-97690691 GGAAAAGGAGGGGCCAGGCCCGG - Intergenic
935271396 2:101437225-101437247 AGCCCAGGAGTTGCCCAGCCTGG + Intronic
936155949 2:110047657-110047679 TGCCGAGGAGGTGCCCAGCCAGG + Intergenic
936188739 2:110323771-110323793 TGCCGAGGAGGTGCCCAGCCAGG - Intergenic
936261819 2:110966340-110966362 GGGCCAGCAGGGGTCCAGCAGGG + Intronic
936307579 2:111356121-111356143 GGACCCTGAGAGGCCCAGCCTGG + Intergenic
936331582 2:111552508-111552530 GTCCCAGGAGAGGCCCACCCAGG + Intergenic
936463296 2:112726768-112726790 GGCCCAGCAGGGGCGGAGCCGGG + Intronic
936979404 2:118250371-118250393 GGACCAGGAGCTGCCCAGGATGG + Intergenic
937082005 2:119146992-119147014 GGACCAGGAGGAGGCCATTCTGG - Intergenic
937220964 2:120343272-120343294 AAACCAGGAGGTGGCCAGCCTGG + Intergenic
937237319 2:120438609-120438631 GGCCCAGGATGGGGCCACCCAGG + Intergenic
937343947 2:121111263-121111285 GCATCAGGATGGGCCCAGACTGG - Intergenic
937869828 2:126778870-126778892 GTCCCAGGTGAGGCCCAGCCTGG - Intergenic
937908407 2:127063917-127063939 GGAACAGGTGAGGCCCAGCACGG - Exonic
938108487 2:128549139-128549161 AGACCAGAGAGGGCCCAGCCAGG - Intergenic
938339104 2:130523659-130523681 GGACCAGCAGGGACACAGGCAGG + Intronic
938350734 2:130597091-130597113 GGACCAGCAGGGACACAGGCAGG - Intronic
940205400 2:151196484-151196506 GGACCAGAAGGGGCAGAGCCAGG - Intergenic
940908298 2:159188420-159188442 AGGCCAGGATGGGGCCAGCCTGG + Intronic
942653645 2:178194053-178194075 GGCCCAGGAGCGCCGCAGCCGGG - Intergenic
946231231 2:218292335-218292357 GGCCCAGGAGCGGGCAAGCCGGG + Intronic
946351784 2:219160275-219160297 GGACCGGGCGGGGCCCAGCCGGG - Intronic
947348711 2:229220567-229220589 GCAGCAGGCAGGGCCCAGCCTGG + Intronic
947581323 2:231320850-231320872 GGAACAGGTGGGGCCAAGCATGG + Intronic
947665137 2:231900686-231900708 GGACCAGCAGTGGCCAAGGCCGG + Intergenic
948309258 2:236972750-236972772 GTACCAGGAGGGGCTGAGCTGGG - Intergenic
948468462 2:238163199-238163221 GCACCAGGTGGAGCTCAGCCTGG + Intronic
948597749 2:239091370-239091392 GGACTTGGGGGTGCCCAGCCCGG + Intronic
948765167 2:240215771-240215793 GGGCCAGGGAGGCCCCAGCCAGG - Intergenic
948826512 2:240575746-240575768 GGACCATGTGGGCCCCAGGCTGG + Intronic
948855284 2:240727448-240727470 GGACCTGAAGGGGACCTGCCCGG + Intronic
948867365 2:240782752-240782774 GGCCCTGGAGGGACCCTGCCTGG - Intronic
948888892 2:240897348-240897370 GGAACAGGAGTGGGCCAGCTTGG - Intergenic
948961740 2:241344273-241344295 GCACCAGGGGTGGCTCAGCCTGG - Intronic
949003773 2:241633664-241633686 GGCCCAGGAGGCCGCCAGCCAGG - Exonic
949060512 2:241953837-241953859 GGAGCCGGAGGTGCCCAGGCCGG + Intergenic
1169422510 20:5471559-5471581 GGACAGGGAGGAGTCCAGCCTGG - Intergenic
1169426955 20:5504210-5504232 AGACAGGGAGGGGTCCAGCCTGG + Intergenic
1169630540 20:7625994-7626016 GGAAGAGGAGGGGGCAAGCCTGG + Intergenic
1170437826 20:16348981-16349003 GTACCAGGATGGGACCAGGCTGG - Intronic
1170665741 20:18384649-18384671 GGACCAGGAGGGGCCCAGCCTGG - Intronic
1171296057 20:24018225-24018247 GGACCAAGAGAGAACCAGCCAGG - Intergenic
1171367188 20:24633372-24633394 AAACCAGGAGGGGCACAGCAGGG - Intronic
1172107619 20:32526240-32526262 GGCCCATGTGGGCCCCAGCCTGG + Intronic
1172457944 20:35092581-35092603 GGACCAGGAGGGGCGGGGCGGGG - Intronic
1172596488 20:36154383-36154405 GGACCAGGGTGGGGGCAGCCGGG + Intronic
1172603149 20:36197301-36197323 GGGCTAGGAGGGGCCCAGACTGG + Intronic
1173225030 20:41157559-41157581 AGCCCTGGAGGGGCCCTGCCTGG + Intronic
1173404199 20:42751150-42751172 GGAACAGCAGAGGCCCAGGCTGG - Intronic
1174357960 20:50010600-50010622 GGACCTGCAGGTGCCCAGCCCGG + Intergenic
1174404827 20:50296323-50296345 GTACCAGGCTGGGTCCAGCCTGG + Intergenic
1174404828 20:50296326-50296348 GGTCCAGGCTGGACCCAGCCTGG - Intergenic
1175161525 20:57011558-57011580 GGACCAGGTGGGTTCCTGCCAGG + Intergenic
1175270827 20:57733117-57733139 GGACAAGGAGGGGCTCAGGGGGG - Intergenic
1175456831 20:59121724-59121746 GGATCAGGAGGGACTCATCCAGG - Intergenic
1175527500 20:59645532-59645554 GGACGAGGAGAGGTCCAGGCTGG - Intronic
1175874708 20:62223889-62223911 GGAGCAGGAGGGGCCCCGCCTGG + Intergenic
1175916572 20:62428644-62428666 CCACCAGCAGGGGCCCTGCCAGG - Intergenic
1175946622 20:62562030-62562052 GGACACAGAGGGGACCAGCCAGG + Intronic
1176063483 20:63182416-63182438 GGCCAGGGTGGGGCCCAGCCCGG + Intergenic
1176149299 20:63581239-63581261 GGACTAGGAAGGTCCCTGCCAGG - Intergenic
1176860083 21:14007212-14007234 GGACATGGAGGGACCCAGCCTGG + Intergenic
1178891304 21:36523077-36523099 GGATCAGGAAGGGTCCAGCCAGG - Intronic
1178901841 21:36604988-36605010 GGACCAGGAGGGAACCAAGCTGG + Intergenic
1178910529 21:36669739-36669761 GTGCCATGTGGGGCCCAGCCAGG + Intergenic
1179545683 21:42111151-42111173 GGACCAGGGGAGCCCCAGCCAGG + Exonic
1179630442 21:42674594-42674616 GGACAAGGCGGGGCCCCTCCTGG - Intronic
1179674711 21:42974017-42974039 CGCCCAGGACGGGCCCACCCGGG + Intergenic
1179708029 21:43193813-43193835 GAACCAGGAGGGGCCTCGCCAGG - Intergenic
1179794376 21:43774374-43774396 TGACCTGGAGGGGCGCAGCAAGG - Intronic
1179933263 21:44586072-44586094 GGCCCAGGAGGCTCCCAGCCTGG - Intronic
1179985456 21:44918379-44918401 GTACCTGGTGGGGCCCGGCCTGG + Intronic
1180025368 21:45158140-45158162 GGAGGCGGAAGGGCCCAGCCTGG + Intronic
1180069155 21:45427509-45427531 GGAGCAAGAGGGGGCCTGCCTGG - Intronic
1180784539 22:18539473-18539495 GGCCAAGGAGGAGCCCAGCAGGG + Intergenic
1180875060 22:19171355-19171377 GGACCAGCGGGGGCCCACGCTGG - Intergenic
1180939111 22:19645267-19645289 GGAAAGGGAGGTGCCCAGCCAGG - Intergenic
1180975151 22:19844097-19844119 GAGCCAGGTGGGGCCCAGCACGG + Intronic
1181128116 22:20713526-20713548 GGCCAAGGAGGAGCCCAGCAGGG + Intronic
1181241442 22:21478830-21478852 GGCCAAGGAGGAGCCCAGCAGGG + Intergenic
1181559319 22:23690884-23690906 GTCCCAGGAGGGGCCCAGGCAGG - Exonic
1182719441 22:32385568-32385590 GTCCCAGGAGGGGCCCAAACAGG - Intergenic
1183022671 22:35039735-35039757 AGGCCAGGAGGTGGCCAGCCAGG + Intergenic
1183356895 22:37364468-37364490 GGGCCAGCTGGGGCCCAGGCAGG + Intergenic
1183476386 22:38038370-38038392 GGACCAGGCCGGGCCCAGGCAGG + Intronic
1184335165 22:43848608-43848630 GGGCCAGGTGGGGCCAAGGCAGG + Intronic
1184466259 22:44670174-44670196 GGACCAAGAAGGGCCCATCCTGG + Intronic
1184651930 22:45923373-45923395 GAACCTAGAGGGGCCCAGCTTGG - Intronic
1184691503 22:46119400-46119422 AGTCCAGGAAGGGCCCAGCCAGG + Intergenic
1185298013 22:50063770-50063792 GGCCCATGGGGGGCCCAGCCAGG - Intronic
1185339835 22:50286339-50286361 GCCCCAGGGGAGGCCCAGCCTGG - Intronic
1185351638 22:50342841-50342863 GGACGGGGAGGGGCCAGGCCTGG + Intergenic
1185364753 22:50432343-50432365 GGACGTGGAGGGACCCAGCCTGG + Intronic
949134086 3:541507-541529 GTGCCAGGATGGGCCCAACCAGG - Intergenic
950210647 3:11120487-11120509 GGAACAGCAGGGGGCCAGGCAGG + Intergenic
950482663 3:13254306-13254328 TGGCCAGGAGGTGCCCAGGCTGG + Intergenic
950670487 3:14522579-14522601 GGCCCAGGCGGGGCCGAGCTGGG + Intronic
953133952 3:40166940-40166962 GGAGCAGGAGGGGCCCTACCAGG - Exonic
953244286 3:41176609-41176631 GGACAGGGAGGGTCTCAGCCAGG + Intergenic
953302018 3:41787026-41787048 GGACCAAGAGAGGGGCAGCCTGG + Intronic
953727037 3:45408522-45408544 AAACCAGGAGGGGGCCAGCTTGG - Intronic
953824869 3:46242571-46242593 GAACAAGGAGGGGTCCAGGCAGG + Intronic
954136114 3:48582955-48582977 GAACCAGAAAGGGCACAGCCAGG + Intronic
954289534 3:49642436-49642458 GGCCCAGGAGGACCACAGCCTGG + Exonic
954708837 3:52495150-52495172 ATGCCAGGAGGGTCCCAGCCGGG + Intergenic
954840807 3:53509669-53509691 GGCCCTGTAGGAGCCCAGCCAGG + Intronic
955226191 3:57062385-57062407 GAACCATGATAGGCCCAGCCAGG + Intronic
955317875 3:57953785-57953807 GAACCAGGAGGGGTCAGGCCCGG + Intergenic
955386343 3:58484168-58484190 GGACCCAGAGAGACCCAGCCTGG + Intergenic
955860576 3:63325579-63325601 AGGCCAGCAGGGGCCCTGCCAGG - Intronic
958905170 3:99934032-99934054 GGACTAGGAGAGCCTCAGCCGGG + Intronic
960947695 3:122978187-122978209 GGCCCAGGTGGGGCCAGGCCTGG - Intronic
960962481 3:123082139-123082161 GGGCAAGGAGGGTCCCAGCAGGG - Intronic
961324625 3:126102921-126102943 GGACCCAGAGGGGCAGAGCCAGG + Intergenic
961360584 3:126364815-126364837 GGCCCAGCAGGGGCCCTGGCTGG + Intergenic
961457825 3:127032992-127033014 GGGCCAGGAGGGAGCCTGCCAGG + Intronic
961673149 3:128549375-128549397 GTAGAAGGAGGGGCCCTGCCTGG + Intergenic
961710469 3:128824316-128824338 GGAGCAGCAGGGTCACAGCCTGG - Intergenic
961754864 3:129121689-129121711 GGTCCGGGCGGGGCCGAGCCGGG - Exonic
962825434 3:139096303-139096325 GGACACAGAGGGGCACAGCCTGG + Intronic
963076015 3:141346667-141346689 GGACCAGGCTGAGCCCAGCTGGG - Intronic
965757455 3:172040404-172040426 TGTCCCGGAGAGGCCCAGCCGGG - Intronic
965803946 3:172523348-172523370 GGTCCAGGGGGGACCCAGCCTGG - Exonic
966287054 3:178310154-178310176 AGCCCAGAAGGAGCCCAGCCAGG + Intergenic
966854383 3:184184198-184184220 GGCCCAGGAGGGGCCTAACTGGG - Intronic
966910110 3:184554933-184554955 GTAGCAGGAGGGACCCAGACAGG + Intronic
967100360 3:186210754-186210776 GGGCCAAGAGGAGCCCACCCTGG + Intronic
967777575 3:193400187-193400209 GGAACAGGGAGTGCCCAGCCTGG - Intergenic
968047416 3:195631939-195631961 GGCCCAGGAGGAGCCTGGCCAGG - Intergenic
968307197 3:197657985-197658007 GGCCCAGGAGGAGCCTGGCCAGG + Intergenic
968477601 4:819683-819705 GGAGTAGGACGGGCCCACCCTGG + Intronic
968576515 4:1368802-1368824 GGACCAGGACGGACCCAGCAGGG - Intronic
968601798 4:1513112-1513134 GCCCCAGGAGGGTCCCAGCACGG + Intergenic
968621040 4:1603584-1603606 GGCACTGGAGGGGTCCAGCCTGG + Intergenic
968627559 4:1634026-1634048 ACACCAGGAGGGGCCCAGGGAGG + Intronic
968673054 4:1862653-1862675 GGACGGGGCGGGGCCTAGCCAGG + Intergenic
968815372 4:2818799-2818821 GGAGCTGGTGGGGTCCAGCCGGG + Intronic
969330536 4:6471631-6471653 GGACAGGGAGGGGCCCGGGCAGG + Intronic
969375462 4:6760702-6760724 GGAGCAGGATGGGACCAGCCGGG - Intergenic
969573118 4:8021726-8021748 GGAGCAGGGTGGCCCCAGCCAGG + Intronic
969620976 4:8278681-8278703 GGACCTGGTGGGGCCCTGCAGGG + Intronic
976557068 4:86461996-86462018 GGCCCAGGATGGGCCCTGCATGG - Intronic
980550598 4:134328924-134328946 GGAGCATGAGGGGCCAGGCCTGG - Intergenic
981713715 4:147732704-147732726 GGGCCAGGCGGGGCCCAGGCGGG - Intronic
983348938 4:166562151-166562173 GGTCCAGGATGGTCCTAGCCTGG + Intergenic
984699504 4:182809578-182809600 GGACCAGGCAGGGCCCAGGAGGG - Intergenic
984834033 4:184002525-184002547 GAGCCAGGTGGGGCCCAGCAGGG + Intronic
985427354 4:189843775-189843797 TGACCACCAGGGGCCCTGCCAGG + Intergenic
985499419 5:232465-232487 GGACCCTGAGGGGCCGAGGCAGG - Intronic
985536264 5:467393-467415 GGACCAGGAGGGCGCCCTCCAGG - Intronic
985536304 5:467531-467553 GGACCAGGAGGGCGCCCTCCAGG - Intronic
985536318 5:467577-467599 GGACCAGGAGGGCGCCATCCAGG - Intronic
985536346 5:467669-467691 GGACCAGGAGGGCGCCATCCAGG - Intronic
985536372 5:467761-467783 GGACCAGGAGGGCGCCATCCAGG - Intronic
985536412 5:467899-467921 GGACCAGGAGGGCGCCCTCCAGG - Intronic
985536426 5:467945-467967 GGACCAGGAGGGCGCCCTCCAGG - Intronic
985536455 5:468037-468059 GGACCAGGAGGGCGCCCTCCAGG - Intronic
985536469 5:468083-468105 GGACCAGGAGGGCGCCCTCCAGG - Intronic
985536498 5:468175-468197 GGACCAGGAGGGCGCCCTCCAGG - Intronic
985536512 5:468221-468243 GGACCAGGAGGGCGCCCTCCAGG - Intronic
985536526 5:468267-468289 GGACCAGGAGGGCGCCCTCCAGG - Intronic
985536540 5:468313-468335 GGACCAGGAGGGCGCCCTCCAGG - Intronic
985536555 5:468359-468381 GGACCAGGAGGGCGCCCTCCAGG - Intronic
985536570 5:468405-468427 GGACCAGGAGGGCGCCCTCCAGG - Intronic
985536585 5:468451-468473 GGACCAGGAGGGCGCCCTCCAGG - Intronic
985536600 5:468497-468519 GGACCAGGAGGGCACCCTCCAGG - Intronic
985576495 5:675674-675696 GGACCAGCAGGGGCCCAACAAGG - Intronic
985650218 5:1104092-1104114 GACCCAGGAGGGGCCTGGCCTGG + Intronic
985677759 5:1241055-1241077 GGCTCAGGAGGGGCGCGGCCTGG + Intronic
985699287 5:1360947-1360969 GGACCATGAGGGGCCCCTGCAGG - Intergenic
985764141 5:1768066-1768088 GGAGCATGCAGGGCCCAGCCAGG + Intergenic
985777326 5:1851596-1851618 GGACAAGGAGGGGCGGAGACAGG - Intergenic
985780161 5:1866317-1866339 GGAACAGGAGGGGCCTCTCCAGG + Intergenic
985995040 5:3593064-3593086 CTACCAGGAGGGGCTGAGCCAGG + Intergenic
985995119 5:3593463-3593485 TCTCCAGGTGGGGCCCAGCCAGG + Intergenic
991957111 5:72005989-72006011 GGACCAGGAAGAGGCCAGGCAGG + Intergenic
997528208 5:134566929-134566951 GGACCAGGCGGGGCCCACAGAGG - Intronic
999250616 5:150180232-150180254 GGCCAAGGAGGGGCCCAATCTGG + Intronic
999261195 5:150239917-150239939 GGACGAGGACTGGCCCCGCCAGG - Intronic
999754406 5:154653659-154653681 TGACCAGGGGTGGCCCAGCTTGG + Intergenic
1000225210 5:159254741-159254763 GGACCAGGAAAGGAACAGCCTGG + Intergenic
1000908150 5:166988718-166988740 GGACATGGAGGGCTCCAGCCAGG - Intergenic
1001159213 5:169299601-169299623 GGACTAAGAGGAGCCCACCCCGG + Intronic
1001413087 5:171524496-171524518 AGAACAGGAGAGGCCCAGCCTGG + Intergenic
1001528842 5:172448176-172448198 GCAGCAGCATGGGCCCAGCCTGG + Intronic
1001816330 5:174672189-174672211 GGCCCAGGAGGTGCGCAGGCTGG - Intergenic
1001846146 5:174923107-174923129 GCAACAGGATTGGCCCAGCCGGG - Intergenic
1002073708 5:176695952-176695974 GAAGCAGGATGGGGCCAGCCCGG + Intergenic
1002109628 5:176899629-176899651 GGAGCTGGAGGCGCCTAGCCTGG + Intergenic
1002190016 5:177473240-177473262 GGGCCAGGCGGGGCACTGCCGGG - Intronic
1002639405 5:180623623-180623645 GGACCAGGAGGGGACAGGGCTGG - Intronic
1003113129 6:3265435-3265457 GGCCCTGGAGGGGCACAGCTTGG + Intronic
1003426340 6:6000432-6000454 GGGGCAGGTGGGGACCAGCCCGG - Intronic
1004493688 6:16143038-16143060 GGAGTTGGAGGGGACCAGCCAGG + Exonic
1006038567 6:31234115-31234137 ACACCATGAGGGGCCCATCCCGG - Intergenic
1006375904 6:33671469-33671491 GGACCAGAGGGGTCCCTGCCCGG + Intronic
1006447186 6:34086224-34086246 GGATGAGGAGCTGCCCAGCCTGG + Intronic
1006581497 6:35080194-35080216 GGACAGGGAGGGGCCGAGTCAGG + Intronic
1006680670 6:35795038-35795060 GGTCAAGGAGGTGGCCAGCCCGG + Exonic
1007448783 6:41927408-41927430 GGACGAGGAGTGGCCCACCCTGG + Exonic
1007727187 6:43923696-43923718 GGTCTGGGAGTGGCCCAGCCAGG + Intergenic
1008093470 6:47315357-47315379 ACACCATGAGGGGCCCATCCCGG - Intergenic
1008205776 6:48654500-48654522 GGACTAGGAGGGGGTCAGACTGG - Intergenic
1012986570 6:105882569-105882591 GGACTAGGAGGAGGCAAGCCAGG - Intergenic
1013432154 6:110064711-110064733 GGAACAGGAGAGGAGCAGCCTGG - Intergenic
1015910100 6:138161604-138161626 GGAGTCGGAGCGGCCCAGCCCGG - Intergenic
1018203511 6:161415956-161415978 GGACCCGGAGGGAGCCAGCTGGG - Intronic
1018724309 6:166598944-166598966 TGCCCAGGCAGGGCCCAGCCCGG + Intronic
1018903882 6:168064189-168064211 GGTCAGGGTGGGGCCCAGCCAGG - Intronic
1019137834 6:169922290-169922312 GAAGCAGGACGGGCCCAGGCGGG + Intergenic
1019769892 7:2876990-2877012 AGACCAGCCGGGGCACAGCCCGG - Intergenic
1022375524 7:29807479-29807501 GGACCTGGAGGAGCGCCGCCCGG + Intronic
1023134050 7:37033227-37033249 GGAGCAGGAGGAGCGCAGACGGG + Intronic
1023869759 7:44256929-44256951 GGCCCAGGAGGGACACAGTCCGG + Intronic
1023876889 7:44291276-44291298 GGACAAGCAGGTGCCCCGCCAGG + Intronic
1024360588 7:48463514-48463536 GGACCAGAAAGGACCCATCCTGG - Intronic
1025916991 7:65873585-65873607 GGGCCAGGAGCGGCCGAGCGGGG + Intronic
1026023993 7:66731012-66731034 GAACCAGGAGGCCCGCAGCCTGG - Intronic
1026533977 7:71224776-71224798 GCCCCAGGTGGAGCCCAGCCTGG + Intronic
1032020548 7:128405338-128405360 GCCCCAGGAGAGGCCCAGCCAGG - Intronic
1032087743 7:128892642-128892664 TGCCCAGGAGGGGCTCAGCAGGG + Intronic
1032470415 7:132174600-132174622 GGAAGAGGTGGGGCCAAGCCAGG - Intronic
1032470751 7:132177307-132177329 GGCCCATGAAGGGCCCAGCTGGG + Intronic
1034899534 7:154899141-154899163 GGACCTGCAGGGGACCTGCCTGG + Intergenic
1035285032 7:157800245-157800267 GGACGAGAAGAAGCCCAGCCTGG - Intronic
1035311977 7:157975182-157975204 GGAACTGGAGGGCCCCAGCGTGG - Intronic
1035410159 7:158633549-158633571 GGTCCAGTAGAGGCCCAGCGAGG - Intronic
1035448136 7:158956915-158956937 GGACCAGGATGGGCACGGGCAGG + Intergenic
1035781839 8:2233760-2233782 GGAGCAGGAGGATCCCAGCAGGG + Intergenic
1035810279 8:2485646-2485668 GGAGCAGGAGGATCCCAGCAGGG - Intergenic
1036557958 8:9876503-9876525 GGGCCAGGTGAGCCCCAGCCTGG - Intergenic
1036711966 8:11085581-11085603 GGACGAGGAGGGGGCCAGAGCGG + Intronic
1037835752 8:22213901-22213923 GGTCCAGGGTAGGCCCAGCCAGG + Intergenic
1037967719 8:23146802-23146824 GGACCAGGAGGGGCCAACGCAGG + Intronic
1039800344 8:40949146-40949168 GGACCAGGTGGGACCCTGGCAGG + Intergenic
1040495335 8:47960752-47960774 GGACCAAGGGGGGCCGAGCGAGG + Intronic
1040609033 8:48964227-48964249 GCACCATGAGGGGCCCATCCGGG + Intergenic
1041014068 8:53573465-53573487 GGACCAGGAAAGGGACAGCCTGG + Intergenic
1044658239 8:94570683-94570705 GCACCTTGAGGGGCCCAGGCAGG + Intergenic
1044750179 8:95408202-95408224 TGACCAGGAGGGGACCAAGCCGG + Intergenic
1047022012 8:120785273-120785295 GGACCAGGAGGGGTATGGCCTGG + Intronic
1047445267 8:124913758-124913780 GGATCAGGAGGTGCAGAGCCAGG - Intergenic
1048302239 8:133260245-133260267 GGGCCAGGAGGAGCCCAGCCAGG + Intronic
1048869146 8:138783030-138783052 GGACCAGGAGGGTCTAATCCTGG + Intronic
1049214362 8:141400989-141401011 GCACCAGGAAGGGGCAAGCCGGG + Intronic
1049250831 8:141588189-141588211 GCCCCAGGAGGGTGCCAGCCTGG + Intergenic
1049328863 8:142039099-142039121 GGCAGAGCAGGGGCCCAGCCTGG - Intergenic
1049576381 8:143391787-143391809 GGGCCAGGTGGGGCACAGGCAGG - Intergenic
1049680048 8:143914081-143914103 GGAACAGGAGTGGCCCCGGCCGG - Intergenic
1049707683 8:144050475-144050497 GGGCGAGGAGGGGCGGAGCCAGG + Intergenic
1050009723 9:1173126-1173148 GGGGCAGCAGGGGCCCAGCCCGG - Intergenic
1050498398 9:6268212-6268234 GTGGCAGGAGGGGCCCGGCCAGG + Intergenic
1053067399 9:35078308-35078330 GGAGCAGCAGGGGCCCAGGTTGG - Exonic
1053163088 9:35827095-35827117 TGACCAGCAGGGGCCAAGCACGG - Intronic
1056777333 9:89523058-89523080 GGACAAGGAGTGAGCCAGCCAGG - Intergenic
1056949197 9:91028609-91028631 GGAGCAGCTGGGGGCCAGCCAGG - Intergenic
1061008736 9:127942999-127943021 GGGCCAGGAGGGTCCCAGCATGG + Exonic
1061132433 9:128715425-128715447 GAAGCAGGAGGTGCTCAGCCGGG + Exonic
1061144153 9:128787398-128787420 TGGCCAGGAGTGGCCCAGCCGGG - Intronic
1061188705 9:129069804-129069826 GGGCCAGGCGGGGCCCAGGTAGG - Intronic
1061538769 9:131266118-131266140 GGAGGAGAAGGGGCACAGCCTGG - Intronic
1062024002 9:134332177-134332199 TGAGCAGCAGAGGCCCAGCCTGG + Intronic
1062231589 9:135484961-135484983 GGGGCCGGCGGGGCCCAGCCAGG + Exonic
1062449263 9:136608684-136608706 GCGCCGGGTGGGGCCCAGCCTGG + Intergenic
1062567519 9:137169923-137169945 CGACCAGGAAGGGCCCCGCATGG + Exonic
1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG + Intronic
1062624288 9:137435916-137435938 GGCCCAGGAGGGGCCCAGGCTGG - Intronic
1062629391 9:137457028-137457050 GGAGCTGTTGGGGCCCAGCCAGG - Intronic
1062710393 9:137972170-137972192 GGGCCAGGATGGGCCCCTCCAGG + Intronic
1062710394 9:137972173-137972195 AGGCCTGGAGGGGCCCATCCTGG - Intronic
1185480112 X:439437-439459 GAACCCTGAGTGGCCCAGCCTGG - Intergenic
1185603780 X:1355509-1355531 GGCCCAGGGGAGACCCAGCCAGG + Intronic
1185999893 X:4997487-4997509 TCACCAGGAGGGGCACAGCTGGG - Intergenic
1190050952 X:47147838-47147860 GGACCACTAGGGGACAAGCCAGG + Intronic
1193257456 X:79367005-79367027 GGAGCAAGAGGGGCCCTCCCAGG + Intronic
1196847964 X:119911726-119911748 AGACAAGGAGTTGCCCAGCCTGG + Intronic
1197775840 X:130118210-130118232 AGATCAGGAGGGGCTCAGACTGG + Intergenic
1199792949 X:151171936-151171958 GGAGCAGGAGGGGCAGGGCCTGG + Intergenic
1199976146 X:152895996-152896018 GGCCCTGGGGCGGCCCAGCCTGG + Intergenic
1200074722 X:153545234-153545256 GGGCCACTTGGGGCCCAGCCTGG + Intronic
1200112748 X:153750453-153750475 TGTCCAGGAGGGGCTCAGCATGG + Intergenic
1200116213 X:153770805-153770827 GCACCAGGTGGGGACCTGCCAGG - Exonic