ID: 1170667129

View in Genome Browser
Species Human (GRCh38)
Location 20:18395875-18395897
Sequence TGGGCCCTGTCTAACTCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170667129_1170667137 22 Left 1170667129 20:18395875-18395897 CCCCATGAGTTAGACAGGGCCCA 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1170667137 20:18395920-18395942 ACACCATTAGCACCTTGCCAGGG 0: 1
1: 0
2: 0
3: 2
4: 93
1170667129_1170667136 21 Left 1170667129 20:18395875-18395897 CCCCATGAGTTAGACAGGGCCCA 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1170667136 20:18395919-18395941 AACACCATTAGCACCTTGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170667129 Original CRISPR TGGGCCCTGTCTAACTCATG GGG (reversed) Intronic
906256472 1:44354839-44354861 TGGGCCCTGGTTAATGCATGCGG - Intronic
907612435 1:55885990-55886012 TGGCCCCTTTCTGACTCAGGTGG - Intergenic
909495685 1:76275521-76275543 TGGGCCCTGTCTGAGTCAAGGGG - Intronic
913335264 1:117703802-117703824 AGGGCCCTGTATAACTGCTGTGG - Intergenic
915460064 1:156064996-156065018 AGGGCCCAGTCTTACCCATGTGG - Intronic
918388532 1:184036090-184036112 TGGGCTCTGTCTTCCTCAGGGGG + Intronic
919880060 1:201895292-201895314 TGGGCACTGTGTCACACATGTGG - Intergenic
920030196 1:203032945-203032967 TGGCCCATGTCTAACTCCTGGGG + Intronic
921780846 1:219161605-219161627 TGGGCCCTGACTATATTATGTGG - Intergenic
1062831788 10:610719-610741 TGGGCGGTGACTGACTCATGGGG + Intronic
1065785295 10:29207384-29207406 TGGGCCCTGACTCACTAGTGGGG + Intergenic
1068438538 10:57021042-57021064 TGGGAACTGTAAAACTCATGTGG + Intergenic
1068607506 10:59022319-59022341 TGGGCCCTGACTAAATCGAGAGG - Intergenic
1069049078 10:63773329-63773351 TGGTCCCTGTTTACCTAATGTGG + Intergenic
1069431968 10:68345247-68345269 TTGGCCCTGTCTAATGCAAGAGG + Exonic
1070436441 10:76398192-76398214 TGGGCCTTGATTAGCTCATGCGG + Intronic
1072455552 10:95572508-95572530 TGAGCCCTGTTTATCTCATTTGG + Intergenic
1077379365 11:2221775-2221797 TGGCCCAGGTCTATCTCATGGGG + Intergenic
1077882726 11:6363840-6363862 TGGGACCTGTCCAGCTCTTGGGG - Intergenic
1078259313 11:9689859-9689881 TGGGCCCTGTGGAGCTGATGGGG + Intronic
1078924470 11:15861510-15861532 TGAGCCAAGTCCAACTCATGAGG + Intergenic
1079429462 11:20375139-20375161 TGGTTCCTGTCTATATCATGAGG + Intronic
1079588547 11:22154852-22154874 TGGGCCATATCTGTCTCATGGGG + Intergenic
1082825313 11:57573389-57573411 TCTGCCCTGTCTACTTCATGCGG + Intergenic
1083226151 11:61286146-61286168 TGGTTCCTGTCTGACTGATGTGG - Intronic
1088728062 11:112656876-112656898 TGGGGCCTGTCTGACTGGTGAGG - Intergenic
1091219740 11:133923070-133923092 TGTGCTCTGTGTAGCTCATGGGG - Intronic
1091638089 12:2213404-2213426 AGGGCCCTGTCTGTCCCATGTGG + Intronic
1095644251 12:44524161-44524183 TGTCCCCTGTCTAACTCAACTGG + Intronic
1096651214 12:53062792-53062814 TGAGCCCTGGCCAACCCATGAGG + Intronic
1098287369 12:68920997-68921019 TGGCCCCTGCTTAACTCTTGGGG + Intronic
1100112192 12:91259345-91259367 TGGGCCATTTCTAACCCATGCGG - Intergenic
1100739277 12:97573290-97573312 TGGGCCCTGTTTACCTCTTCAGG + Intergenic
1102034625 12:109763857-109763879 TGGTCCCTGTTTTACTGATGAGG - Intronic
1103909735 12:124345655-124345677 TGGACCCTGTCTTGGTCATGCGG + Intronic
1106815008 13:33397922-33397944 TGGGTCGTGTTTAGCTCATGGGG - Intergenic
1110658763 13:78033084-78033106 TGGGCCCTGTCTAATACATTGGG + Intergenic
1112920900 13:104611715-104611737 TATGACTTGTCTAACTCATGAGG + Intergenic
1114428965 14:22644243-22644265 TGAGCCCTTCCCAACTCATGTGG + Intergenic
1118758438 14:68862694-68862716 TGGGGACTGTCCAACCCATGTGG - Intergenic
1123043952 14:105502470-105502492 TGGTTCCTGTTTATCTCATGGGG + Intergenic
1128087413 15:64895610-64895632 TGTGCCCTGTACAACTCAAGAGG - Intronic
1130622024 15:85473497-85473519 TGGGGCCTATTTAACTTATGTGG - Intronic
1132699609 16:1216704-1216726 TGGGCTCTGTCTACCTGGTGAGG + Intronic
1135248024 16:20873862-20873884 TGGTCCCTGTTTATCACATGGGG + Intronic
1137878185 16:52017741-52017763 TCTTCCCTCTCTAACTCATGAGG - Intronic
1149340653 17:55682792-55682814 TGTGCCCTGTGTTTCTCATGGGG - Intergenic
1151662753 17:75527378-75527400 TGGGCCCAGTCTAACTTCAGAGG - Intronic
1155541896 18:26877435-26877457 TGAGAGCTGTCAAACTCATGAGG + Intergenic
1156480648 18:37434469-37434491 TGGCCCCTGTCTAAAACAGGGGG + Intronic
1157219541 18:45817502-45817524 TGGGCCCAGGGTATCTCATGAGG + Intergenic
1160167945 18:76530367-76530389 TGGCCCCTGTCTTACAGATGAGG + Intergenic
1161484247 19:4526110-4526132 TGGGCCCTGTTTTACACAGGAGG + Intronic
928283559 2:29969808-29969830 TGGGGCCTGTCACACTCTTGAGG - Intergenic
929766088 2:44845043-44845065 TGGCCCCTCTCTAACACATGGGG - Intergenic
932160464 2:69455144-69455166 TGTGCCCTGTTTAACTCTAGAGG + Intergenic
932227441 2:70053829-70053851 TGGGTTTTGTCTACCTCATGTGG - Intergenic
933349563 2:81136634-81136656 TGGGCCCTGTAGAAGTCAAGGGG - Intergenic
935417866 2:102837719-102837741 TGGGCCCTGAGTACCTCAAGTGG + Intronic
945476839 2:210293447-210293469 TCAGCCCTGTCTAACTCATAGGG + Intronic
946155967 2:217806840-217806862 AGGGCCATGTCTGACACATGGGG - Intronic
1170667129 20:18395875-18395897 TGGGCCCTGTCTAACTCATGGGG - Intronic
1174397736 20:50258405-50258427 TGGGCCCTTTCTCACTCGGGAGG + Intergenic
1174549027 20:51348165-51348187 AGGGCCATGGCTTACTCATGAGG - Intergenic
1178634037 21:34287054-34287076 TGGGCCCAGTCTCACTCAAGGGG - Intergenic
1179906169 21:44424394-44424416 TGGGACATGTCTCACTCGTGTGG - Intronic
1183480117 22:38059155-38059177 TGGGCCCTCTAAAACTCCTGAGG - Intronic
949397970 3:3635338-3635360 TGTGCCATGTCTTACTCTTGAGG - Intergenic
950430873 3:12950289-12950311 TGGGGCCAGGCTAACTCTTGGGG - Intronic
952492866 3:33888537-33888559 AGGGCCCTGTCTGACTCCTTGGG - Intergenic
953107858 3:39902865-39902887 TGGGCACCGTCTATCTCATGAGG + Intronic
953546536 3:43867603-43867625 TGGGCCATGGCAAACACATGGGG - Intergenic
954788559 3:53113501-53113523 TGGAACCTGTCTCAGTCATGTGG + Intronic
956408098 3:68949750-68949772 TGGGAGGTGTCTAAATCATGAGG - Intergenic
961542136 3:127607217-127607239 TGGGACCTGTCTGGCTCACGTGG + Intronic
967194207 3:187012596-187012618 TGGGCCCAGGCTAACAGATGAGG + Intronic
973650885 4:52996151-52996173 TGGTCCCTGACTGACTCAGGGGG - Intronic
982378358 4:154720290-154720312 TGGGGCATGGCTAACTAATGTGG + Intronic
984132608 4:175897002-175897024 TGGGCCCTGACTGATTCATGAGG - Intronic
989543016 5:42640096-42640118 TGGGACTTTTCTATCTCATGTGG + Intronic
992197606 5:74355197-74355219 TGGGCCCTGGCAAAGTCAGGAGG - Intergenic
997342450 5:133155418-133155440 TGGGCCCAATCTAATTAATGGGG + Intergenic
997922937 5:137999856-137999878 GGGTTCCAGTCTAACTCATGAGG + Intronic
1001744779 5:174083924-174083946 TGGCCCCTATCTAACGCATGTGG - Intronic
1003520215 6:6851918-6851940 TGGCCCGTGTCTCTCTCATGAGG - Intergenic
1006421245 6:33935513-33935535 TGGGCCCTGCCTGACAGATGAGG - Intergenic
1006919973 6:37621106-37621128 TGGGCTTTGTCTAAAACATGTGG + Intergenic
1016797571 6:148134093-148134115 TGAACCCTGTCTAAAGCATGTGG - Intergenic
1024421420 7:49171343-49171365 TGGGCCTTGTATGACTCACGAGG - Intergenic
1029705559 7:102274033-102274055 TGGGCCCTGAGTCACTCCTGAGG - Intronic
1029795579 7:102890832-102890854 TGGGCCATGTCTATCTCAGATGG - Intronic
1030127582 7:106169121-106169143 AGGCCCCTGGCTCACTCATGGGG - Intergenic
1034737145 7:153439917-153439939 AGGGCCCTATCTCATTCATGAGG - Intergenic
1034737432 7:153441841-153441863 AGGGCCCTATCTCATTCATGAGG + Intergenic
1038325266 8:26568014-26568036 TGGGCAGTGTGTAACTCCTGTGG - Intronic
1040372200 8:46788135-46788157 TGGGCCATGCCTGACTCCTGAGG - Intergenic
1047279779 8:123435003-123435025 TGAGCCCTGTATAAATCCTGAGG - Intronic
1047518039 8:125572186-125572208 TGGGCCCTCTCTTCCTCATGCGG + Intergenic
1047813160 8:128432450-128432472 TGGGCCCTTTCTAATGCATCTGG - Intergenic
1052804553 9:33001266-33001288 TGGGCCCTGTCCAACCAAGGAGG - Intronic
1057049100 9:91908527-91908549 TGGTCCCTATCTACCTCCTGGGG - Intronic
1059785400 9:117577311-117577333 TGGGACCTGATTAAGTCATGAGG + Intergenic
1062214338 9:135380940-135380962 TGGGCCCTTTCCTTCTCATGAGG + Intergenic
1187232365 X:17435120-17435142 TTGGCCCAGTCTACCTCATGTGG - Intronic
1189599170 X:42603553-42603575 TGAGTCCTGTCTATCTTATGGGG + Intergenic
1195785595 X:108517993-108518015 TTGGCTCTGTATAGCTCATGTGG - Intronic
1196659918 X:118258936-118258958 TGGGCTCTGACTGACTTATGTGG - Intergenic