ID: 1170668266

View in Genome Browser
Species Human (GRCh38)
Location 20:18405886-18405908
Sequence AGGGAGAGCACAGTGACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170668254_1170668266 26 Left 1170668254 20:18405837-18405859 CCCCAGCAGCAGCTATACAGGAT No data
Right 1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG No data
1170668255_1170668266 25 Left 1170668255 20:18405838-18405860 CCCAGCAGCAGCTATACAGGATG No data
Right 1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG No data
1170668253_1170668266 27 Left 1170668253 20:18405836-18405858 CCCCCAGCAGCAGCTATACAGGA No data
Right 1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG No data
1170668256_1170668266 24 Left 1170668256 20:18405839-18405861 CCAGCAGCAGCTATACAGGATGG No data
Right 1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170668266 Original CRISPR AGGGAGAGCACAGTGACTGG GGG Intronic