ID: 1170668693

View in Genome Browser
Species Human (GRCh38)
Location 20:18409761-18409783
Sequence CAATAACAACACAAAGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 817
Summary {0: 1, 1: 3, 2: 23, 3: 106, 4: 684}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170668690_1170668693 8 Left 1170668690 20:18409730-18409752 CCTATAACATATAGAAATAAGAT 0: 1
1: 0
2: 7
3: 102
4: 910
Right 1170668693 20:18409761-18409783 CAATAACAACACAAAGAAGGTGG 0: 1
1: 3
2: 23
3: 106
4: 684

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170668693 Original CRISPR CAATAACAACACAAAGAAGG TGG Intronic
900729927 1:4250496-4250518 CAATAATAACAAAAAGAAACAGG - Intergenic
900794474 1:4699731-4699753 AAAATACAACTCAAAGAAGGTGG - Intronic
900891157 1:5450743-5450765 AAATGACAACACAAAAATGGGGG + Intergenic
901148780 1:7086413-7086435 CAATAAAAATAAAAAGAAGAAGG - Intronic
901852321 1:12023365-12023387 AAATAAGAAAACAAAGAAGGTGG - Intronic
902153859 1:14467166-14467188 CATTAACAGCACAAAAGAGGAGG + Intergenic
902263319 1:15243589-15243611 CAAGAACAGCCCAGAGAAGGTGG + Intergenic
902709405 1:18228218-18228240 TAATAGGAGCACAAAGAAGGTGG - Intronic
902752616 1:18527951-18527973 CTAAAACAACACAGAGAAGGGGG + Intergenic
902798699 1:18816057-18816079 TAATAAAAACAAAAACAAGGTGG - Intergenic
902827764 1:18988800-18988822 CAGAAATAACACAAAAAAGGAGG + Intergenic
904056089 1:27671220-27671242 CTATAACAACACCACGAAGTAGG + Intronic
906026265 1:42676590-42676612 CAAGAACACCACCAAGAAGAAGG - Exonic
906308368 1:44735792-44735814 CAAAAAAAAAAAAAAGAAGGTGG - Intergenic
906697750 1:47836015-47836037 CAATAATGGCACAAAGGAGGAGG + Intronic
906749883 1:48249323-48249345 CAATAACAGGACAATAAAGGAGG - Intergenic
908057252 1:60302167-60302189 CAATAAAAGCACAAAGGAAGTGG - Intergenic
908804575 1:67916854-67916876 CAATAATAGCCCAAAGAAGCAGG - Intergenic
908877604 1:68695817-68695839 GAATAATAAAACAAAAAAGGAGG + Intergenic
908879648 1:68716433-68716455 AAATAAAAACAGAAAGAAGGAGG - Intergenic
908967463 1:69783078-69783100 CAACAACAACAAAAAGCAAGTGG - Intronic
909074039 1:71031567-71031589 CAAGCATAACACAAAGAAGAAGG + Intronic
909625918 1:77715904-77715926 CAAAAACAACAGAAGAAAGGAGG + Intronic
909685449 1:78343204-78343226 CAATAAGAACACATAGACGCAGG - Intronic
910093184 1:83489595-83489617 CAATAATAACACCAACAAAGAGG - Intergenic
910226340 1:84940003-84940025 CGATAACAACCCAATGAAGCAGG + Intronic
910277095 1:85461491-85461513 CAATAACAATAGAAAGAGGCAGG + Intronic
910576022 1:88764892-88764914 CAATAACAACAAAAAACAGGAGG - Intronic
910932917 1:92460395-92460417 CAACAACAACAAAAAAAAGTTGG - Intergenic
911094204 1:94042637-94042659 CAATGACTACACTCAGAAGGGGG - Intronic
911122749 1:94312427-94312449 CAAAAAAAAAAAAAAGAAGGAGG - Intergenic
911147190 1:94563774-94563796 CAACAACAACAAAAAGAAAATGG - Intergenic
911404037 1:97413635-97413657 CAAAAACAACACAAAAAATTAGG - Intronic
911812447 1:102300301-102300323 TAAGAACAACATAAAGAATGTGG - Intergenic
913155573 1:116093575-116093597 CAACAACAACACCAAGAAAATGG + Intergenic
914767568 1:150652771-150652793 TAATAATAGCACAAAGAAAGAGG + Intronic
914998831 1:152568625-152568647 CAATAACAGTATACAGAAGGGGG - Intronic
915092452 1:153436047-153436069 CAAAAAAAAAAAAAAGAAGGAGG + Intergenic
915254757 1:154618807-154618829 AAATAAAAACACCAAGAAGCAGG + Intronic
915566434 1:156716092-156716114 CACTAAAAACACAAATAAGCTGG - Intergenic
915699312 1:157775746-157775768 CAAGAACAACAAAGACAAGGAGG + Intronic
916026271 1:160836323-160836345 GAAAAACAGCACAAAGAAGAGGG + Intronic
916065126 1:161130574-161130596 CAATAACAAACCAAAGCTGGGGG + Intronic
916401647 1:164455234-164455256 CAATAACAATACAAAGAACGTGG + Intergenic
916522024 1:165572180-165572202 CAAAAAAAACAAAAAAAAGGAGG - Intergenic
917080766 1:171254853-171254875 CAATAAGAGCACAAAGAAAGAGG - Intronic
917307966 1:173646678-173646700 CAATAGCAAAACAAAGAAAGAGG + Intronic
917566898 1:176221831-176221853 AAATAACAACAAGAAAAAGGTGG - Intergenic
917893021 1:179457508-179457530 CAAAAATAACACAAAGTATGGGG - Intronic
918084751 1:181236183-181236205 CAATAACAAAACAATCAGGGGGG - Intergenic
918322508 1:183377707-183377729 CAATAACAACAAAAAGTACAAGG + Intronic
919345804 1:196376725-196376747 CAATTAAAAAAGAAAGAAGGAGG + Intronic
919713684 1:200753448-200753470 AAAGAGGAACACAAAGAAGGAGG - Intronic
920883942 1:209908269-209908291 CATTAACAGCACAAAAGAGGTGG - Intergenic
921141110 1:212307392-212307414 CACTAATATCACAAAAAAGGAGG - Intronic
921141119 1:212307517-212307539 TAATAACAGCACAAAGGAGGAGG - Intronic
921452676 1:215327392-215327414 CAATAACAACACAAAGGAGCGGG + Intergenic
921657287 1:217755118-217755140 CAATTACAAAACAAAAAAAGAGG + Intronic
921752346 1:218810458-218810480 CAATAACAACTGAAAGGAGGAGG - Intergenic
921808591 1:219485134-219485156 CAATAATATCACAAAGAACAAGG - Intergenic
921824407 1:219655977-219655999 CAATAGCAAGACAAAGAGAGGGG - Intergenic
922593503 1:226796603-226796625 AAAAAACAACAAAAAAAAGGTGG + Intergenic
922736889 1:227990241-227990263 CCATATCAACAGAATGAAGGGGG + Intergenic
923417164 1:233774646-233774668 CAATAAAAACACTAAGAAAGTGG - Intergenic
924516411 1:244769703-244769725 CAATAACAAGATAAAGTGGGAGG + Intergenic
924563047 1:245172822-245172844 CAAAAACAAAACAAAGAGGGTGG + Intronic
1062993552 10:1843496-1843518 CCATAACAACAGATAAAAGGAGG - Intergenic
1063343524 10:5291170-5291192 CAAAGACATCACCAAGAAGGTGG - Intergenic
1063809290 10:9685084-9685106 CAATAACAGAACAAAGGAGTTGG + Intergenic
1064116711 10:12584462-12584484 TTATAACAACACAAAGAGGTGGG + Intronic
1064826341 10:19406887-19406909 CCATAAAAACACAAAATAGGAGG + Intronic
1065030995 10:21585710-21585732 TAATAAAAACACAAAGATGCTGG - Intronic
1065147318 10:22782701-22782723 CAACAACAACAAAAATAAGGTGG + Intergenic
1065929241 10:30464606-30464628 CAAGGAAAACACAAAGGAGGTGG - Intergenic
1066016691 10:31252263-31252285 CCATATTAACAAAAAGAAGGGGG - Intergenic
1066044067 10:31580951-31580973 CAACAACAACAAAAACAAGAGGG - Intergenic
1066045549 10:31592320-31592342 CAACAACAACAACCAGAAGGAGG - Intergenic
1066368875 10:34802901-34802923 CAACAACCCCACAAAGCAGGTGG + Intronic
1066688763 10:38005944-38005966 CAACAACAACAAAAAGAAATGGG + Intergenic
1067003924 10:42643403-42643425 CAACAACAACAAAAAGAAGTGGG - Intergenic
1068472627 10:57484134-57484156 GAATAACAACATATTGAAGGAGG + Intergenic
1068736019 10:60414497-60414519 TAATTACAAAACAAAAAAGGTGG + Intronic
1069272752 10:66550701-66550723 CAAAAAGAAAACAAAGAAGTGGG - Intronic
1069371717 10:67754742-67754764 CAAAAACAACCCATAGAACGGGG + Intergenic
1069641071 10:69955849-69955871 CCATAATAACACAGAGGAGGAGG - Intronic
1070105502 10:73427128-73427150 CAATAACACCAAAAATAAGCAGG + Intronic
1070245372 10:74726243-74726265 CAATAAAAGCATAAAGAGGGAGG + Intergenic
1070312528 10:75284111-75284133 CAATAAGTAAGCAAAGAAGGAGG + Intergenic
1070564452 10:77592948-77592970 CAATTCCAGAACAAAGAAGGTGG - Intronic
1071051509 10:81455413-81455435 GAATAATGGCACAAAGAAGGTGG - Intergenic
1071084831 10:81857533-81857555 CAATAACAGCATAAAGCAGTGGG - Intergenic
1071183324 10:83012330-83012352 CAATTGCAACAAAAAGGAGGAGG + Intergenic
1071330414 10:84553303-84553325 AAATAACATCAAAAAGAAGATGG - Intergenic
1071469243 10:85968544-85968566 CAACAATAATATAAAGAAGGGGG + Intronic
1071479689 10:86055742-86055764 CAACAACAACAAGAAGAAGAAGG + Intronic
1071992437 10:91113048-91113070 AAATAACAACAAAATGAAGATGG - Intergenic
1072103108 10:92247875-92247897 CAAAAACAAAACAAAGGATGGGG - Intronic
1073454018 10:103625892-103625914 CAACAACAACAAAAAGAATGTGG + Intronic
1073499686 10:103925150-103925172 AAATAATAGCACAAAGAAGGTGG - Intergenic
1073667473 10:105550045-105550067 CCATAACAGCACAAAGAAGGTGG + Intergenic
1073888848 10:108073102-108073124 CAATAACAACAAAAAGAGTGGGG - Intergenic
1074294610 10:112172503-112172525 CTATAACAACAGAAATAAGTTGG + Intronic
1074694292 10:116034492-116034514 CAATAACAGCTCAAAGAAGCGGG - Intergenic
1075150155 10:119921795-119921817 TAATAACAATACAAATAAGACGG - Intronic
1076004494 10:126937857-126937879 CAATAACAAGATAAAGAAGTTGG - Intronic
1076326541 10:129627894-129627916 CAATATCAACACAATAAAGCAGG - Intronic
1076772427 10:132673485-132673507 CAATTACAACACCAACTAGGTGG - Intronic
1077203192 11:1324191-1324213 AAAAAGCAACACAAATAAGGAGG + Intergenic
1077213387 11:1383653-1383675 CAAAAACAAAACAAAAAAGTGGG - Intergenic
1077715504 11:4575971-4575993 CAATAACCACAGAAAGGAAGTGG + Intronic
1078241631 11:9535685-9535707 CAAAAACAAAACAAAGAGTGTGG - Intergenic
1078454520 11:11464851-11464873 CAATAACCCCACAAGGAAGTAGG - Intronic
1078589130 11:12622868-12622890 AAATAACAGCACAAATAAGAGGG + Intergenic
1078646916 11:13149146-13149168 CAAAAACATCACAGAGAGGGAGG + Intergenic
1078911156 11:15733452-15733474 CAATCACAACAGCAAGGAGGTGG - Intergenic
1079176818 11:18149837-18149859 CAGTAAGACCACAAAGAATGAGG - Intronic
1079432852 11:20412561-20412583 CAAAAACAAAACAAAAAAGGTGG - Intronic
1079583855 11:22100497-22100519 AAATAACAACATAAAGAGTGGGG + Intergenic
1079881489 11:25932863-25932885 CAAAAAAAAAAAAAAGAAGGGGG - Intergenic
1079930521 11:26554120-26554142 CTATAATGACACAAAGCAGGTGG - Intronic
1080623280 11:34005388-34005410 CAAAAACCACACAAGGCAGGTGG - Intergenic
1081715500 11:45247085-45247107 CAATAACCACACCTTGAAGGAGG + Intronic
1081777617 11:45686406-45686428 CAACAACAAAACAAAAAAGCTGG + Intergenic
1082251711 11:49989412-49989434 CAATAACAACACAAAGTAGAAGG - Intergenic
1082556773 11:54572049-54572071 CAATAAAAACACAAAATAGAAGG + Intergenic
1082639737 11:55643804-55643826 CAATAAGAAAACAAACAATGTGG + Intergenic
1084264735 11:67999069-67999091 CAATAATAAAAGAAAGAAAGTGG + Intronic
1084573118 11:69971578-69971600 CAAAAACAAAACAAACAAGAAGG - Intergenic
1084924131 11:72498238-72498260 CAATAATAGCACAAAGCAGGAGG - Intergenic
1085361635 11:75893261-75893283 GAATAGAAACACAAAGAAGTGGG + Intronic
1085829665 11:79885880-79885902 CAGAAACAATACAAAGAAAGAGG - Intergenic
1086320254 11:85638800-85638822 CAATAACAACACAAAAGCAGGGG - Intergenic
1086561744 11:88176378-88176400 CAAAAACAACAAAAAGAAGTTGG - Intergenic
1086693643 11:89818334-89818356 CCATAATTACACAAATAAGGTGG - Intergenic
1086712503 11:90026235-90026257 CCATAATTACACAAATAAGGTGG + Intergenic
1087069003 11:94056633-94056655 CAATAATAGCACAAAGGAGGGGG - Intronic
1087553962 11:99690367-99690389 CAACAACAAAACAAAGCTGGAGG - Intronic
1087696810 11:101388228-101388250 CAATAGCAACACAATGGAAGTGG - Intergenic
1088039045 11:105354054-105354076 CTATAAAAACACTAATAAGGGGG - Intergenic
1089150590 11:116360817-116360839 TAATAAACACACAAAGAAGCTGG + Intergenic
1089255378 11:117191275-117191297 CAAAAAAAAAAAAAAGAAGGGGG + Intronic
1089569049 11:119390361-119390383 CAAGAACAGCAGAAAGAAGGAGG - Intergenic
1089834174 11:121355663-121355685 CCATAAAAACACAAAGAATGGGG + Intergenic
1090303462 11:125669009-125669031 CAATAATAGCACAAAGGATGAGG - Intronic
1090705905 11:129336384-129336406 CAATAATAACACAAAAAAAGAGG - Intergenic
1090743305 11:129686722-129686744 CAATAACAATACAGAGGAGGAGG + Intergenic
1093168383 12:15831519-15831541 CACTGACAAGCCAAAGAAGGAGG - Intronic
1093283699 12:17230322-17230344 CAAAAAAAACACAAAGCTGGAGG - Intergenic
1093311860 12:17598434-17598456 CAATAAAAACATAAAGGAGAGGG + Intergenic
1093795995 12:23311704-23311726 CAAAAATAGCACAAAGAATGGGG + Intergenic
1094603019 12:31926914-31926936 CAAAAACAAAACAAAAAAAGAGG - Intergenic
1095196854 12:39329421-39329443 CACTAAGAACAAAGAGAAGGAGG + Intronic
1095207773 12:39458024-39458046 GAATAAGAAAGCAAAGAAGGAGG + Intergenic
1095537257 12:43264888-43264910 CAATAACAAGTCAAGGAAGTTGG + Intergenic
1096008046 12:48187937-48187959 TAATAACAGCACCAAGAAGATGG + Intergenic
1096288228 12:50318714-50318736 CAACAACAACAAAAAACAGGGGG - Intergenic
1096330285 12:50705990-50706012 CAATAAGAAAACAAAGCAGCAGG - Intronic
1098513313 12:71344713-71344735 AAAGAAGAAGACAAAGAAGGAGG + Intronic
1098607954 12:72417011-72417033 TAAAAACAACACAAAAAAAGGGG - Intronic
1099296033 12:80829075-80829097 CTAGAACAAACCAAAGAAGGTGG + Intronic
1099525613 12:83715426-83715448 CAAAAACAAGACAAAGAACAAGG + Intergenic
1099538947 12:83881309-83881331 CATAAGCAATACAAAGAAGGTGG - Intergenic
1099593942 12:84633130-84633152 AAATATAAACACAAATAAGGAGG + Intergenic
1100792855 12:98149758-98149780 CAATGACAATACAAGAAAGGAGG - Intergenic
1100910016 12:99349026-99349048 CAATAACAACACAAACACATGGG + Intronic
1101054707 12:100900272-100900294 AAATAAAAAGAGAAAGAAGGAGG - Intronic
1101805147 12:108057061-108057083 CACAGACAACACACAGAAGGAGG - Intergenic
1102389238 12:112536296-112536318 CAAAAACAAAACAAAAAAGCAGG + Intergenic
1103035814 12:117655403-117655425 CAATTACAACACCAACTAGGTGG + Intronic
1103456815 12:121074532-121074554 CAATACCAACATACAGAATGGGG + Intergenic
1104343500 12:127974300-127974322 ACATAACGACACTAAGAAGGGGG - Intergenic
1104714636 12:131008345-131008367 CAATACAAAGACAAAGACGGAGG - Intronic
1105047591 12:133018093-133018115 CAATAACACCACAAAGGAGGAGG + Exonic
1105933479 13:25075088-25075110 CAATTACTATACAAAGAGGGAGG + Intergenic
1106037303 13:26055377-26055399 CAATTACAATAAAAATAAGGAGG - Intergenic
1107048494 13:36021097-36021119 CAATAATAGCACAAAAGAGGAGG + Intronic
1107599423 13:41998095-41998117 AAAAAAAAACACAAAGAATGTGG + Intergenic
1108124508 13:47226494-47226516 CCATAACAACACTAAGGAGAGGG - Intergenic
1108136888 13:47374133-47374155 AAATAACAGCACAAAGGAGGGGG - Intergenic
1108810166 13:54213251-54213273 CAATAACAATGCAATGATGGGGG - Intergenic
1108863039 13:54885711-54885733 CAATAACAGCAAAAAAGAGGAGG - Intergenic
1109104509 13:58234093-58234115 CAACAACAACAAAAAAATGGAGG + Intergenic
1109252639 13:60038458-60038480 GATTAAAAACACAAAGCAGGTGG - Intronic
1109286868 13:60420187-60420209 CAACAACAACAAAAAGAAATTGG + Intronic
1109362921 13:61319866-61319888 AAATAAAAAAACAAAGAAGCTGG + Intergenic
1109613446 13:64797060-64797082 CAATAACAATACTAAGAAGGAGG - Intergenic
1110032989 13:70641044-70641066 CAATAAAAGCACAAAAAAGTTGG + Intergenic
1110176293 13:72559826-72559848 CAAGAACAAGAAAGAGAAGGAGG + Intergenic
1110212129 13:72986160-72986182 CAAAAACAAAACAAAAAAGAAGG + Intronic
1110436683 13:75483776-75483798 AAATAACAATAGAAAGAATGAGG - Intergenic
1110578120 13:77084372-77084394 CAATATATGCACAAAGAAGGAGG - Intronic
1110833614 13:80059738-80059760 CAATAAAAACACAAAAAACCTGG - Intergenic
1110890903 13:80696460-80696482 CAACAACAACAAAAAGAATTTGG + Intergenic
1111078249 13:83266754-83266776 CAAAAACAGCACAAAGAAGGTGG - Intergenic
1111457148 13:88499721-88499743 CAAAAAAAAAAAAAAGAAGGTGG + Intergenic
1112031180 13:95458266-95458288 CAAGAACAACAAAAACACGGAGG - Intronic
1112101084 13:96190247-96190269 CAATAAGAACGCAAAGGAGCTGG - Intronic
1112150715 13:96759572-96759594 CAACAATAACACAAAGAATAGGG - Intronic
1112687537 13:101848455-101848477 CAAAAACAAGAGAAAGGAGGAGG + Intronic
1113206228 13:107919978-107920000 CAATAACATCATTAAGAAGATGG + Intergenic
1114138662 14:19885428-19885450 CAATACCAGCACAAAGAAGTGGG - Intergenic
1114218062 14:20672512-20672534 AAATAAAAAATCAAAGAAGGGGG - Intergenic
1115190637 14:30744110-30744132 CAAAAACTATACAAAGAAGATGG + Intergenic
1115210260 14:30960327-30960349 CAAGAAAAACAAAAAGAATGAGG + Intronic
1115744352 14:36420536-36420558 GAATCAAAACACAAAGAGGGAGG + Intergenic
1116245789 14:42410376-42410398 CAATAACAGCATAAAGGAAGAGG - Intergenic
1116773317 14:49151865-49151887 CCACAAGAACGCAAAGAAGGAGG - Intergenic
1116859156 14:49979727-49979749 CAACAATAACACCAAAAAGGAGG - Intergenic
1116987243 14:51234033-51234055 CAACAACAGCATAAAGATGGTGG + Intergenic
1118707200 14:68491240-68491262 CAATCACAACAGAAAGGAGGAGG - Intronic
1119763310 14:77169831-77169853 CAAAAGCAACATAAAGATGGGGG - Intronic
1120063141 14:80008911-80008933 CAACAACAACACAAAAAAGTTGG - Intergenic
1120220226 14:81723374-81723396 AAATAATAACACAAAAAATGTGG + Intergenic
1120818994 14:88894646-88894668 CAAAAACAAAAAAAAGAAGGAGG - Intergenic
1121266528 14:92606381-92606403 CAATAACAACAAAAATTAGCTGG + Intronic
1122496717 14:102161903-102161925 GAACAACAAGTCAAAGAAGGAGG - Intronic
1122510827 14:102266303-102266325 CAAAAACAAAAAAAAAAAGGAGG - Intronic
1122571411 14:102705122-102705144 CAACAACAACAAAAAAAAAGAGG + Intronic
1122736247 14:103844271-103844293 AAATAAAAAAAAAAAGAAGGTGG + Intronic
1123016398 14:105377608-105377630 CCTAAACAACACGAAGAAGGTGG + Intronic
1123456915 15:20434747-20434769 CAAAAACAATACCAAAAAGGAGG + Intergenic
1123661146 15:22565609-22565631 CAAAAACAATACCAAAAAGGAGG - Intergenic
1124143287 15:27096730-27096752 CAACAAATACAAAAAGAAGGTGG - Intronic
1124196770 15:27638708-27638730 CAATAAAATCACCAAGGAGGAGG + Intergenic
1124263065 15:28209890-28209912 CAAAAACAATACCAAAAAGGAGG + Intronic
1124314946 15:28659845-28659867 CAAAAACAATACCAAAAAGGAGG - Intergenic
1124406144 15:29393673-29393695 CAATAAAAACACCAGGAATGGGG - Intronic
1125643259 15:41249170-41249192 CAAAAACCAAAAAAAGAAGGTGG - Intronic
1125668707 15:41453720-41453742 CAACAACAACAAAAAAAAGTAGG + Intronic
1126175048 15:45728369-45728391 CAACAACAACAAAAAGAGGGTGG + Intergenic
1126615106 15:50570015-50570037 AAAAAACAACAAAAAAAAGGGGG + Intronic
1126647724 15:50892037-50892059 CAATAGTAAAACAAAGAAGAAGG - Intergenic
1126839771 15:52706266-52706288 TAATAAAACCACAATGAAGGGGG + Intronic
1127601751 15:60544469-60544491 CAACAACAACAAAAAAAAGCAGG - Intronic
1128630241 15:69257951-69257973 CTACAACAACAAAAAGAATGGGG - Intronic
1128818896 15:70634597-70634619 CAACAACAACACAAATTAGCTGG + Intergenic
1129026769 15:72583356-72583378 CAAAACAAACACAAACAAGGAGG + Exonic
1129527976 15:76234592-76234614 CAACAGAAACAGAAAGAAGGAGG + Intronic
1129933473 15:79431265-79431287 CAAGAACAACACAAACAAAAAGG - Intergenic
1130206788 15:81883847-81883869 CAATAACAAGACAGTGGAGGAGG + Intergenic
1130327189 15:82890351-82890373 CAACAACAACAAAAACCAGGTGG + Intronic
1130827431 15:87563955-87563977 CGATAATGACAAAAAGAAGGTGG + Intergenic
1130929088 15:88408842-88408864 CTGTAACAATACTAAGAAGGTGG - Intergenic
1131043596 15:89295739-89295761 CAACAACAAAAAAAAAAAGGTGG - Intronic
1131079019 15:89518809-89518831 CAACAACAACAAAAAAAAGTTGG + Intergenic
1131681954 15:94732770-94732792 CAATAAACACACAAATAAAGGGG - Intergenic
1131803428 15:96096446-96096468 CAAAAGCAAAACAGAGAAGGAGG - Intergenic
1133587906 16:7213560-7213582 AAAAAAAAACACAAACAAGGTGG + Intronic
1133871565 16:9693005-9693027 CAACACTAACACAAAGAGGGAGG - Intergenic
1134213237 16:12295407-12295429 CAAAAACAAAACTAAGAAAGTGG - Intronic
1135625497 16:23991207-23991229 CCATAGCAACACAAAGATGCTGG + Intronic
1136100651 16:27993142-27993164 CAACAACAACAAAAAGCAAGTGG - Intronic
1136280627 16:29207738-29207760 CAATAATAGCACAAAGAATGAGG + Intergenic
1137065478 16:35837319-35837341 CAAAAACAACACAAAGAAAAAGG + Intergenic
1138142313 16:54579385-54579407 GAAAAACAACACAAAGATGGGGG - Intergenic
1139051342 16:63128945-63128967 CAACAACAACAAAAAGTGGGGGG + Intergenic
1139080806 16:63518069-63518091 CAATAATAGCATAAAGAAGATGG - Intergenic
1139443789 16:66983991-66984013 CAGTGACAACACAAAGGAGGTGG - Intergenic
1139974449 16:70797746-70797768 CAAGAACAGCACCAAGAAGATGG - Intronic
1141391946 16:83672176-83672198 CAACAACAACCCTAAGAGGGAGG - Intronic
1141702672 16:85649757-85649779 TAATTAAACCACAAAGAAGGTGG + Intronic
1142039720 16:87885196-87885218 CAACAACAACAAAAAAAAGAGGG + Exonic
1142084987 16:88173679-88173701 CAATAATAGCACAAAGAATGAGG + Intergenic
1142219062 16:88844153-88844175 CAATAAAAACCCCAAGCAGGAGG + Intronic
1142572275 17:882759-882781 CAAAAACAAAACAAAGAGGCCGG - Intronic
1142641287 17:1287325-1287347 CAATAACAACAAAAAGAATTTGG - Intronic
1143071842 17:4302031-4302053 CAACAACAACAAAAAAAGGGGGG + Intronic
1144056208 17:11543288-11543310 CAATGATAAGACAAAGGAGGAGG + Intronic
1144114974 17:12079519-12079541 AAATACGAACACTAAGAAGGTGG + Intronic
1144124130 17:12185009-12185031 CAATAACAGTACAAAGGAGATGG + Intergenic
1144387002 17:14757354-14757376 CAATAACAACAAAAAGCCTGTGG + Intergenic
1145717496 17:27035653-27035675 CATTAACAAAACAAACAGGGAGG + Intergenic
1145717746 17:27038747-27038769 CAATAACAGCACCCAGGAGGTGG + Intergenic
1145852336 17:28112640-28112662 CAAAAACAAAACAAAACAGGAGG - Intronic
1146040022 17:29443323-29443345 CAAGAGCAACAAAAAGAAGATGG - Intronic
1146043846 17:29485474-29485496 CAAAAACAAGACAAATAAGCTGG + Intronic
1146277236 17:31523593-31523615 CAATGACATCACAGAGAAGGTGG + Exonic
1146332698 17:31941221-31941243 CAATAAAAAAAAAAATAAGGAGG - Intronic
1146779528 17:35656381-35656403 CAATAAAAATAAAAAGAAAGTGG - Intronic
1147061659 17:37884581-37884603 TAATAAAAACACAAAGATGCTGG + Intergenic
1147549916 17:41433608-41433630 CACTAACAACAGAATGAAGAGGG - Intergenic
1148009664 17:44466912-44466934 CAACAACAACAAAATGGAGGGGG - Intronic
1148018826 17:44540277-44540299 AAAAAAGAGCACAAAGAAGGGGG + Intergenic
1148172072 17:45529972-45529994 CAATAACAGTATAAAGGAGGGGG + Intergenic
1148277212 17:46315822-46315844 CAATAACAGTATAAAGGAGGGGG - Intronic
1148299328 17:46533398-46533420 CAATAACAGTATAAAGGAGGGGG - Intronic
1148363946 17:47038596-47038618 CAATAACAGTATAAAGGAGGGGG - Intronic
1149142788 17:53454487-53454509 CAAAAACAACAATAAGTAGGTGG + Intergenic
1149306605 17:55353409-55353431 CAGTAATAGCACAAAGGAGGGGG + Intergenic
1149314804 17:55428906-55428928 CAACAACAACAAAAAAAAAGAGG + Intergenic
1149754967 17:59178966-59178988 CAATAAAAAATCAAAGAAAGCGG - Intronic
1150031161 17:61737000-61737022 CAATAACAATATAAAAAGGGAGG + Intronic
1150403184 17:64875885-64875907 CAATAACAGTATAAAGGAGGGGG + Intronic
1150506650 17:65705606-65705628 CAATGACACCACAAGGAAGCAGG + Intronic
1150628728 17:66861158-66861180 CAATAACAGCACAAAGGAGTTGG + Intronic
1151695499 17:75714424-75714446 CAATAAAAAGAAAAAAAAGGAGG - Intergenic
1152119454 17:78409310-78409332 CACTAACAACACAATGTGGGTGG + Intronic
1152481599 17:80557542-80557564 CAATAAATACAAAAATAAGGAGG + Intronic
1154035747 18:10800260-10800282 CAACAACAACAAAAAGAGAGAGG + Intronic
1154470841 18:14699410-14699432 CAATAACAGCACCCAGGAGGAGG - Intergenic
1154516664 18:15175658-15175680 AAATAAAAACTCAAAGAACGAGG - Intergenic
1155122467 18:22836581-22836603 CAATAACAATATAAAAAAGGTGG + Intronic
1155445688 18:25910921-25910943 CAATAATAGCACAAAGCAGATGG - Intergenic
1155967932 18:32053449-32053471 CTATAACAATACAAAAATGGGGG + Intronic
1156057811 18:33031676-33031698 CAATATTAACACAAAGAAAGAGG - Intronic
1156437345 18:37146815-37146837 CAATAATGTCACAAAGAATGGGG - Intronic
1156469524 18:37368602-37368624 CACTGCCAACACAGAGAAGGAGG - Intronic
1156578454 18:38347571-38347593 GACTAAGAACACAAAGAAGTTGG - Intergenic
1156672034 18:39482320-39482342 CAATAACAAGAAAAAGAGTGTGG + Intergenic
1157070955 18:44407645-44407667 CAATAATATCACAAAAAGGGAGG + Intergenic
1157657092 18:49401046-49401068 CAGTAAAAACACACAAAAGGGGG + Intronic
1157899277 18:51498514-51498536 AAATATCAACACAAAGTTGGAGG - Intergenic
1157984923 18:52426225-52426247 CAATGAGAACATAATGAAGGTGG + Intronic
1158376318 18:56873472-56873494 CAAAAGGAACATAAAGAAGGTGG + Intronic
1159181631 18:64913997-64914019 AAAAGAAAACACAAAGAAGGAGG - Intergenic
1159526410 18:69596882-69596904 CAATAACAACACAAAGGAGGTGG + Intronic
1159715170 18:71812768-71812790 CAACAACAACAAAAACAATGGGG + Intergenic
1159979377 18:74758452-74758474 CAGTAACAGGACAAAGTAGGGGG - Intronic
1160083097 18:75749007-75749029 CAGTAACAGCACAAATATGGTGG - Intergenic
1160275236 18:77426523-77426545 CAAAAAAAGCACAAAGCAGGAGG - Intergenic
1160700993 19:507345-507367 CAATAAGGACACAAGGAAAGTGG + Exonic
1161128177 19:2571993-2572015 CAACAAAAACACAAAGAGAGAGG - Intronic
1161185337 19:2914880-2914902 CAATAACAGCACAGAGGAGGAGG - Intronic
1161441135 19:4292338-4292360 CAAAAAAAACAAAAAGCAGGAGG - Exonic
1161941298 19:7406071-7406093 CAACAACAACAAAAAGAATCTGG - Intronic
1164230429 19:23282633-23282655 CAATAATAAGACAAATAAGTGGG + Intergenic
1164404332 19:27929715-27929737 CAACAACAACAAAATGAAGTAGG - Intergenic
1164407079 19:27959731-27959753 TAACAATAACACAAAGAAGAGGG - Intergenic
1164657590 19:29935308-29935330 CAATAATAATATAAAGAGGGAGG - Intronic
1166288327 19:41846009-41846031 CAATAAAAAAAAAAAGAAAGTGG + Intronic
1166842272 19:45705058-45705080 CAACAACAACAAAAAGAACTAGG + Intergenic
1166880393 19:45926130-45926152 CTAGAAGAACACAAAAAAGGTGG - Intergenic
1167005559 19:46774383-46774405 CAAAAACAACACAAAAAATTAGG - Intronic
1168264243 19:55213089-55213111 CAACAACAACAAAAAGTAGCTGG - Intergenic
1168446614 19:56422669-56422691 TAAGAACAAAACAATGAAGGTGG - Intronic
1168628464 19:57937622-57937644 CAATGACAAAACCAACAAGGGGG - Intergenic
924983105 2:240981-241003 AAATAATAAGACAAAGAAGTGGG + Intronic
925707822 2:6704707-6704729 CAATGACAGCACAAACAAGATGG + Intergenic
925773434 2:7307281-7307303 CAGATAGAACACAAAGAAGGAGG + Intergenic
926014284 2:9435711-9435733 CAACAACAACAAAAAGAGGCCGG - Intronic
926207403 2:10843834-10843856 CAAAAACAAAACAAAACAGGAGG + Intergenic
926211229 2:10871424-10871446 AAATAACAGCACAAAGGAAGTGG - Intergenic
926302498 2:11614543-11614565 CAACAACAACAACAAAAAGGGGG - Intronic
926873010 2:17444198-17444220 CAATAAAATGAAAAAGAAGGAGG + Intergenic
927180640 2:20444614-20444636 CAACAACAACAAAAAAAAGCTGG + Intergenic
927725961 2:25423205-25423227 AAACAAAAAAACAAAGAAGGAGG + Intronic
928251239 2:29682853-29682875 TGATCACAACAGAAAGAAGGAGG + Intronic
928283451 2:29968680-29968702 CATGAACACCACAAAGAATGAGG - Intergenic
928286854 2:29998046-29998068 CAAAAACATTACAAAGAAGGAGG + Intergenic
928633639 2:33219747-33219769 CAAAAGATACACAAAGAAGGGGG - Intronic
928728235 2:34201020-34201042 CAATAAGAAGACAAATAATGAGG + Intergenic
928826785 2:35432107-35432129 GAATAACAAAATAAATAAGGTGG + Intergenic
928850929 2:35745280-35745302 CAATATCAGCACAAAGGAGAAGG + Intergenic
929264941 2:39907872-39907894 CAATTACATCAAAAAGCAGGGGG + Intergenic
929391076 2:41469807-41469829 CAACAACAACAACAAGAAAGAGG - Intergenic
929757095 2:44776422-44776444 TCCTAACTACACAAAGAAGGTGG + Intergenic
930004747 2:46887795-46887817 CCATAACAACCCAATGAAGTAGG + Intergenic
930255650 2:49087154-49087176 GAATAACAACACAAATAAACAGG + Intronic
930598593 2:53417617-53417639 CAAAAACAAAACAAAAAAAGTGG - Intergenic
930849160 2:55939402-55939424 CAAAAAAAAAACAAAGAAAGAGG + Intergenic
931123746 2:59250522-59250544 TAATGAGAACACAAAGAAGCAGG - Intergenic
931315799 2:61129627-61129649 CAATAACAGAACAAAGGAGGTGG + Intronic
931650396 2:64463333-64463355 CCAAACCAACCCAAAGAAGGAGG - Intergenic
932342288 2:70973171-70973193 CAATAACAACAAAAATGAGGTGG - Intronic
932546783 2:72719992-72720014 CAATAACAGCACAAAAGAGTAGG + Intronic
932655932 2:73611141-73611163 CAATGTCAACGCACAGAAGGTGG + Intergenic
933279584 2:80318237-80318259 AAGTAACATCTCAAAGAAGGAGG - Intronic
933829002 2:86191409-86191431 CAAAAACAACAAAAAGCAAGAGG + Intronic
933840580 2:86283008-86283030 CATTAACCAGATAAAGAAGGGGG - Intronic
933863710 2:86496854-86496876 CAATAACACTATAAATAAGGAGG - Intergenic
934694904 2:96392724-96392746 CAATGACAGCACCAAGAAGATGG + Intergenic
934875790 2:97918610-97918632 CAAAAACAACAACAAAAAGGCGG + Intronic
934932495 2:98438633-98438655 CAATAATAGCACAAAGAAGTGGG - Intergenic
934936536 2:98469814-98469836 CAACAACAACAAAAAGAACTTGG + Intronic
934973393 2:98781872-98781894 CAATAACAACAACAAAAATGTGG + Intergenic
934982561 2:98856681-98856703 CAATAACAACAAAAAGGAGGAGG + Intronic
935003860 2:99050052-99050074 CAATAAATGCACAAAGAACGTGG + Intronic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
935380273 2:102444733-102444755 CAAGGACAAGGCAAAGAAGGTGG - Intronic
935576258 2:104714437-104714459 CAATAACAACAACAAAAAGATGG - Intergenic
935800587 2:106691378-106691400 CAACAACAACAAAAAGATGTGGG + Intergenic
935804289 2:106730879-106730901 CAATAACAACAAAAAGTAATAGG + Intergenic
935905445 2:107834005-107834027 CAAAAACAAAAAAAGGAAGGGGG + Intronic
936009186 2:108914305-108914327 AAATAAGAACACAAGAAAGGAGG + Intronic
936017296 2:108969321-108969343 CAAGAACAAGACCAAGAAAGTGG - Intronic
936871909 2:117143715-117143737 CAATAACAGCACAAAAGAAGAGG - Intergenic
936874588 2:117172962-117172984 CAAGAACAGCACCAAGAAGATGG - Intergenic
937509665 2:122580525-122580547 TAATTACAGCACAGAGAAGGAGG + Intergenic
937551572 2:123099041-123099063 ATTTAACAATACAAAGAAGGAGG - Intergenic
937559777 2:123207961-123207983 CAACAACAACAAAAAAGAGGGGG - Intergenic
937995127 2:127688218-127688240 CAGTAACAGCACAAAGGAGATGG - Intergenic
938012257 2:127838253-127838275 CAACAACAACAAAAAGATGTGGG - Intergenic
938204575 2:129408301-129408323 CAATTAAAGCACAAAGGAGGAGG - Intergenic
938395446 2:130943724-130943746 CAACAACAACATAAAGGAGGAGG - Intronic
938423717 2:131166369-131166391 CAATAACAACACAAAGGGTGAGG - Intronic
938849805 2:135248911-135248933 CAACAACAACAAAAAAAAGTAGG + Intronic
939840260 2:147179503-147179525 TAATAATAGCACAAAGAAGGAGG - Intergenic
939986934 2:148838483-148838505 CAGTAACCACACAAAGGAGGTGG - Intergenic
940403739 2:153276740-153276762 CAATAAGAAGACAAAGAAGACGG - Intergenic
940780452 2:157927962-157927984 CAACAACAACAAAAAGATGATGG - Intronic
941294030 2:163713830-163713852 CAGTATTAACACAAAGAGGGGGG + Intronic
941297341 2:163756649-163756671 CCATAACAACACTAAGAATATGG + Intergenic
942027883 2:171928501-171928523 CAACAACAACAAAAAAAATGGGG - Intronic
943207030 2:184913192-184913214 CAATAACTACATAAAGAAGGAGG - Intronic
943426231 2:187738313-187738335 CAATAATAAAACAAAAAAGCTGG - Intergenic
943430757 2:187798117-187798139 CAATAACAGCACAGAGGAGGTGG - Intergenic
943508619 2:188795227-188795249 CAAGAACTACAAATAGAAGGAGG - Intergenic
943531801 2:189091782-189091804 CATTAACAATTCAAAGAAGTCGG + Intronic
943680744 2:190765091-190765113 AAATAACACCAGAAAGAAAGAGG + Intergenic
944332055 2:198481204-198481226 AAATAACAAGCAAAAGAAGGAGG - Intronic
944550100 2:200837785-200837807 CAATAATAGCACAAAGTAGCAGG + Intergenic
945346683 2:208726189-208726211 CAACAACAACAAAAAGATGTGGG - Intronic
945365347 2:208946117-208946139 CAATAACAAAACAGAGAGGTTGG - Intergenic
945576855 2:211542001-211542023 CAATAACAATAAAAAAAATGTGG - Intronic
946383906 2:219369949-219369971 CAAATACAAGAGAAAGAAGGAGG + Intergenic
947249668 2:228088050-228088072 CAAAAACATCACAAAGAAAGGGG + Intronic
948719103 2:239885567-239885589 CAATAACAGGACAAAAGAGGTGG + Intergenic
948812248 2:240486228-240486250 CAATAACAGTACAAAGGAAGTGG - Intronic
948982516 2:241501603-241501625 CGATAACCACACAAAGGAGGTGG - Exonic
1168854598 20:999856-999878 CAACAACAACAAAAAGGAGCTGG - Intronic
1169615466 20:7438611-7438633 CAAAAACAAAACAGAGAATGAGG + Intergenic
1169674213 20:8135505-8135527 CAATCACAACAGACAGCAGGGGG + Intronic
1169835816 20:9877138-9877160 CAAACACAGCACAAAGGAGGTGG + Intergenic
1170132740 20:13040228-13040250 CAATAACAGCACAAAGAAATTGG - Intronic
1170407797 20:16057429-16057451 CAATAACAAGTCAAAGAAATTGG + Intergenic
1170668693 20:18409761-18409783 CAATAACAACACAAAGAAGGTGG + Intronic
1172790054 20:37497087-37497109 CAAAAGCAAAACAAAAAAGGGGG + Intronic
1173535443 20:43808399-43808421 CAAAAACAGCACAAGGTAGGAGG - Intergenic
1173740633 20:45398648-45398670 CAATAACAACAGTAAAAATGAGG - Intronic
1174079564 20:47961399-47961421 CAACAACAAAACAAGGAATGGGG + Intergenic
1174286503 20:49477769-49477791 CAAAAACAAAAGAAAGAAAGTGG + Intronic
1174929387 20:54795621-54795643 TAATAATAGCACAAAGAAAGGGG - Intergenic
1175384145 20:58583495-58583517 CAAGAACACCACACAGAAGGAGG - Intergenic
1176803642 21:13458527-13458549 CAATAACAGCACCCAGGAGGTGG + Intergenic
1176809473 21:13522693-13522715 CAATAAAAAAATAAAGATGGGGG - Intergenic
1177027000 21:15932710-15932732 CAAAGACAAAACAAAAAAGGGGG + Intergenic
1177321272 21:19524138-19524160 AAATAACAACACAAATAAAAAGG + Intergenic
1177597459 21:23264079-23264101 AAATAAAAACAGAAAGAAAGAGG + Intergenic
1177674983 21:24285169-24285191 AAATAAAAAAAAAAAGAAGGTGG + Intergenic
1177726336 21:24973106-24973128 TAATGACAGCACAAAGGAGGTGG + Intergenic
1177879962 21:26681416-26681438 CAATAAAAACAAAAAGTGGGAGG + Intergenic
1178625466 21:34214269-34214291 CAACAACAACAAAAAGAAACTGG - Intergenic
1178825768 21:36015506-36015528 CAACAACAACAAAAGGAAGGTGG - Intergenic
1178945573 21:36944578-36944600 CAAAATCAAAACAAAGAAGCAGG - Intronic
1180286145 22:10746504-10746526 CAACAACTACAAAAAAAAGGGGG - Intergenic
1180388150 22:12198837-12198859 TAATAAAAACAAAAAAAAGGGGG - Intergenic
1181544534 22:23594266-23594288 CAACAACAACAAAAAAAAGTTGG + Intergenic
1182316695 22:29452464-29452486 CAACAACAACAAAAAGAAATAGG - Intergenic
1183244209 22:36681204-36681226 CTAAACCAACAGAAAGAAGGTGG - Intronic
1183907967 22:41056950-41056972 CAATAACAGCACAAAGGAGGTGG - Intergenic
1184056674 22:42056305-42056327 CAATAACAGCATAAAGGAGGAGG - Intronic
1184284103 22:43457805-43457827 CAATAATAGCATAAAGGAGGGGG - Intronic
949403510 3:3690294-3690316 CATTAACTACACAAATGAGGGGG - Intergenic
949418952 3:3844884-3844906 CAATAACATCGCAAAGACTGTGG + Exonic
949676568 3:6461226-6461248 TAATAACAGCACCAAGTAGGTGG - Intergenic
949835210 3:8261339-8261361 CAATAACAGTATAAAGACGGAGG - Intergenic
949911869 3:8917498-8917520 CAATAACAATACAAAGAATTAGG + Intronic
951171551 3:19547791-19547813 AAATATCAACACAAGGAAGTTGG + Intergenic
951183496 3:19685628-19685650 CAATAACAACATAAAGTGTGGGG + Intergenic
951716130 3:25648516-25648538 AAATAACAATACAAAGAAACAGG + Intronic
951759777 3:26133861-26133883 CAATAATAGCACAAAGGAGTGGG - Intergenic
952302266 3:32113850-32113872 AAATAACAACAAAAAAAAGGTGG - Intronic
954593496 3:51804483-51804505 CAAGATCAACACAAGGAAGAGGG - Intergenic
954649389 3:52151016-52151038 CAGTATCAACACAAAGCAGCTGG - Exonic
954830010 3:53412717-53412739 CAATAATAGCACAAAGAATGGGG - Intergenic
954971802 3:54657349-54657371 CAAAAACAAAACAAAAAAGAAGG - Intronic
955231873 3:57106728-57106750 CAATAAAAACACAATGAGAGAGG + Intronic
955310922 3:57885717-57885739 CAACAACAACAAAAACAAGATGG - Intronic
955715558 3:61825805-61825827 CAACAACAACAAAAAGTAGCTGG - Intronic
955830090 3:62992238-62992260 CAATAACAAGGAAAAGAATGGGG - Intergenic
956047464 3:65211042-65211064 CAATAAGAACACAAAGATGGTGG + Intergenic
957146508 3:76431711-76431733 AAATAAAAAAATAAAGAAGGAGG + Intronic
957285172 3:78208414-78208436 CAATATTAAAACAAACAAGGAGG + Intergenic
957502810 3:81078644-81078666 CCATGACTACACAAATAAGGGGG + Intergenic
957857932 3:85903097-85903119 CAATAACAGCACAAAGGAAGTGG - Intronic
957906093 3:86557886-86557908 CCATAACAGCACACAGAAGAAGG + Intergenic
958603510 3:96329523-96329545 GAATAACAATACAAAAAATGTGG + Intergenic
958740025 3:98057869-98057891 CCATCACAACACATAGAGGGAGG - Intergenic
958822282 3:98989107-98989129 CAAGAACAACACCAAGGAGATGG - Intergenic
959519420 3:107308331-107308353 CAATAACAGCATAAAGAAGGTGG - Intergenic
959542729 3:107558487-107558509 CAAAAACAACAAAAAACAGGGGG + Intronic
959750249 3:109826364-109826386 CTACAACAAAAAAAAGAAGGGGG - Intergenic
959844550 3:111018393-111018415 CATTCTCAACACAAAGAACGTGG + Intergenic
960651291 3:119953048-119953070 CAATAACAGCAAAAAGGAGGGGG + Intronic
960771895 3:121202332-121202354 CAATAACAAGAAAAAGAAGGTGG - Intronic
960777427 3:121274130-121274152 CACTAAAAACACAAAAAAGCAGG - Intronic
961033656 3:123627437-123627459 CCATTACAACTCAAAGAAGTAGG + Intronic
961160084 3:124716540-124716562 CAACAACAACAAAAAAAAGGTGG + Intronic
962198533 3:133382725-133382747 CACTAACAACCCAGAGCAGGAGG - Intronic
962382420 3:134908664-134908686 CAACAACAGCACAAAGAGGGAGG + Intronic
962547491 3:136452233-136452255 CAACAACAACAACAAAAAGGGGG + Intronic
963100236 3:141594973-141594995 CAGTAACAGCACAAAGGAAGGGG + Intronic
963430519 3:145196338-145196360 CAACAACAACAAAAATGAGGAGG + Intergenic
963822787 3:149917184-149917206 TAATAACAAAACAAAGATGGTGG - Intronic
964231096 3:154468932-154468954 CAATAAAGAAACAAGGAAGGAGG - Intergenic
964249935 3:154701661-154701683 CAATAACAGCACAAAGAAGGTGG + Intergenic
964476592 3:157103149-157103171 CAACAACAACAAAAAAAAGATGG + Intergenic
964691592 3:159455788-159455810 GAAGAACAGCACAAAGAAGAAGG + Intronic
964953975 3:162329267-162329289 CAAAAACAATACTAAGAGGGAGG - Intergenic
965495091 3:169388413-169388435 CACAAACAGAACAAAGAAGGAGG + Intronic
965759673 3:172062308-172062330 CAAAAAAAAAAAAAAGAAGGAGG - Intronic
966419822 3:179726431-179726453 AAAGAACAACACAAAGTAGAGGG + Intronic
966676996 3:182600374-182600396 CAACAACAACAAAAAAAAAGAGG + Intergenic
966981852 3:185144210-185144232 CAATCACAACACCAAGAAGCTGG + Intronic
966992474 3:185247970-185247992 CAGTACCTACACAAAGAAGATGG - Intronic
967301275 3:188016646-188016668 CATTGACACCAAAAAGAAGGTGG + Intergenic
967422615 3:189290896-189290918 CAACAACAACAAAAAGAAATGGG - Intronic
967797502 3:193613551-193613573 CAAAAAAAAAACAAAGAAGGAGG - Intronic
968043602 3:195610125-195610147 CAAAAAAAAAAAAAAGAAGGTGG + Intergenic
968424301 4:511527-511549 CAATAACAGCACAGAGGTGGCGG - Intronic
969197615 4:5575762-5575784 CAACAACAACAAAAAGACTGGGG + Intronic
969236584 4:5869725-5869747 CAAGAACAACCCACAGTAGGTGG + Intronic
969288118 4:6220966-6220988 CAATAAGAACACAAAAAAGCTGG - Intergenic
969358862 4:6648511-6648533 AAATAAAAACACAAACAAGGGGG - Intergenic
970540873 4:17077588-17077610 AAATAACAAAACACAGAAGCTGG - Intergenic
970596922 4:17609111-17609133 CAAAAAAAACAAAAAGCAGGTGG + Intergenic
970675928 4:18450329-18450351 CAATGATAACACAGAGGAGGAGG + Intergenic
970908734 4:21249124-21249146 CAAAATCAACAGTAAGAAGGGGG + Intronic
971084823 4:23261080-23261102 AAAAAACAACACACAGAATGGGG - Intergenic
971115009 4:23635394-23635416 AAATAAAAACACAAACAAGTGGG + Intergenic
971321387 4:25608628-25608650 AAAAAACAAAACAAAGAAAGAGG + Intergenic
972581683 4:40400700-40400722 CAGCAACAACAAAAAGAAGCAGG + Intergenic
972640217 4:40918572-40918594 CAATAACAACACGAACACTGGGG + Intronic
973060376 4:45716756-45716778 CTATAAAAACATAAAGAATGAGG + Intergenic
973565462 4:52182125-52182147 CAATAACATCACAAAAGAGGAGG + Intergenic
973809992 4:54560134-54560156 AAAGAACAAAACAAAGCAGGGGG - Intergenic
973892787 4:55384696-55384718 AAATAAAAATAAAAAGAAGGAGG - Intergenic
974604088 4:64126757-64126779 CAAAAACAAAAAAAAAAAGGAGG - Intergenic
974660287 4:64879617-64879639 CAATAACAACAAAACAATGGTGG - Intergenic
975897121 4:79106510-79106532 CAGTAACAACACAGAGTAGGGGG + Intergenic
975956226 4:79842913-79842935 CAATAACAGCACAAAAAAAGTGG - Intergenic
976855956 4:89605899-89605921 CAATAATAGCGCAAAGAATGTGG + Intergenic
976916625 4:90384082-90384104 CAACAACAACAAAAAAAACGAGG - Intronic
977023858 4:91791144-91791166 AGATAACACCACAAAGATGGGGG - Intergenic
977334130 4:95674508-95674530 CAATAACAACAAAAATCAGCAGG + Intergenic
977632015 4:99253418-99253440 GAAAAACAAAACAAAGAAAGTGG + Intergenic
977887606 4:102271234-102271256 CAAGAAGGACACAAAGGAGGAGG + Intronic
977888113 4:102275299-102275321 CAAAAACAAAACAAAAAAGCAGG + Intronic
978041622 4:104070849-104070871 CAATAACAACATAAGAAAGCAGG + Intergenic
978604557 4:110465335-110465357 AAAGAACAACAAAAATAAGGTGG - Intronic
978652786 4:111027297-111027319 CAGTGACAACAGGAAGAAGGAGG - Intergenic
979012106 4:115385410-115385432 CAACAACAACACAACAAAGCTGG - Intergenic
979223828 4:118262245-118262267 CAATATCAACACAATGACGAAGG - Intergenic
979873344 4:125854379-125854401 AAATAACAACAAAAACAAGAAGG - Intergenic
980114846 4:128669501-128669523 CAACAACAACAAAAATAAGCGGG - Intergenic
980311422 4:131134870-131134892 TAATAACAATACAGAGAAAGAGG + Intergenic
980391025 4:132146743-132146765 CAAAGACGACAAAAAGAAGGAGG - Intergenic
980425707 4:132625224-132625246 CAATAACAGCATAATAAAGGTGG - Intergenic
980682496 4:136181970-136181992 CAATAACAGCGCAAAAGAGGTGG + Intergenic
980765098 4:137291860-137291882 CAATAGCAACACAAATAATATGG - Intergenic
980956543 4:139434314-139434336 CAACAACAACAAAATGGAGGAGG - Intergenic
981018210 4:139997454-139997476 CAGTAACAGCACAAAGAGGGTGG - Intronic
981190484 4:141856569-141856591 CAACAACAACAAAAAAAAGCAGG + Intergenic
981497392 4:145409619-145409641 CAGAAACATCAGAAAGAAGGAGG - Intergenic
981847859 4:149189879-149189901 CAACAACAACAAAAAAAAGGGGG + Intergenic
981875438 4:149538227-149538249 CAGTAACAACACAAAGGAGGAGG + Intergenic
981985618 4:150851308-150851330 CAACAAAAACAAAAAAAAGGAGG + Intronic
982030595 4:151296568-151296590 CAGTAACACCACAAATGAGGAGG + Intronic
982279993 4:153673732-153673754 CAAAAGCAATACTAAGAAGGAGG - Intergenic
982811202 4:159827835-159827857 CAAAAACAACAAACAAAAGGAGG + Intergenic
983223813 4:165067693-165067715 CAAAAACAAAACAAAAAAAGTGG - Intergenic
983319125 4:166172848-166172870 CAATAACAACACACCTAAGAGGG + Intergenic
983505349 4:168547382-168547404 CAATAACACCACAATGAACGTGG + Intronic
984002933 4:174272564-174272586 CAATAAAAACATAAAGGAGAAGG + Intronic
984931599 4:184852619-184852641 TAACAGCAAGACAAAGAAGGAGG - Intergenic
985239219 4:187912285-187912307 CAATAACAACAAAATAATGGGGG + Intergenic
985768072 5:1791575-1791597 CAAAAACAAAAAAAAAAAGGGGG - Intergenic
985862472 5:2483834-2483856 TTATAACAACACAAAAGAGGAGG + Intergenic
986680575 5:10229468-10229490 CAGTAACCACACAGTGAAGGTGG + Intronic
986997860 5:13627824-13627846 CAATGGCAACAGGAAGAAGGAGG + Intergenic
987651287 5:20743600-20743622 CAATAACAGCACAAAGAATGTGG + Intergenic
987728228 5:21731540-21731562 CAATGTCAACACAAAGCAGAGGG - Intergenic
987898117 5:23975789-23975811 CAATAACAACACAAAGTAGGTGG - Intronic
988082236 5:26429158-26429180 CACAAACCATACAAAGAAGGTGG - Intergenic
988714434 5:33811116-33811138 CAACAACAACAAAAACATGGGGG + Intronic
988744274 5:34117843-34117865 CAATAACAGCACAAAGAATGGGG - Intronic
988822957 5:34905823-34905845 CAATTAGAACACAAATAAGGAGG + Exonic
988892541 5:35633932-35633954 CAACAATAGCACAAAAAAGGAGG - Intronic
989635276 5:43525009-43525031 CATTAACAACATAAAGACAGAGG + Intergenic
989716528 5:44469459-44469481 TAATAATAGCACAAATAAGGAGG - Intergenic
989765569 5:45078553-45078575 AAATAAGAGCACAAAGAAGGTGG - Intergenic
989766706 5:45094106-45094128 CAATAAAAACAAAAAGAGGGAGG + Intergenic
989950839 5:50295552-50295574 AGATAAAACCACAAAGAAGGGGG - Intergenic
990351812 5:54925267-54925289 CAATAACAGCATAAAGGAGGAGG - Intergenic
990411294 5:55543725-55543747 TAACAACAACAAAAAGGAGGTGG - Intergenic
990411295 5:55543728-55543750 TAATAACAACAACAAAAAGGAGG - Intergenic
990554433 5:56916815-56916837 CAAGAACAACACATCGAAGTGGG - Exonic
990887990 5:60616169-60616191 AAATAAAACCACAAAGATGGGGG + Intronic
992750500 5:79856765-79856787 CAAGTCCAGCACAAAGAAGGCGG + Intergenic
992771119 5:80049407-80049429 CAATAACAAAAAAAATTAGGTGG - Intronic
993224789 5:85154298-85154320 CAATAAAAACACAGAGATTGGGG - Intergenic
993538257 5:89115334-89115356 CAATTACATCACAAAGATGGAGG - Intergenic
993813017 5:92506417-92506439 CAATAACAGCACAAATAAGGTGG + Intergenic
994098284 5:95867379-95867401 CAATCACAACAGAAACATGGTGG - Intergenic
994144181 5:96374243-96374265 CAATAATAAAATAAAGAAAGAGG - Intergenic
994328836 5:98482146-98482168 CAACAACAACACATAGGAGGAGG + Intergenic
995305434 5:110641636-110641658 CTACAACACCACAAAAAAGGTGG + Intronic
996029368 5:118687784-118687806 AAACCACAGCACAAAGAAGGGGG - Intergenic
996133889 5:119815066-119815088 CTATAACAATGCAAAGAACGAGG - Intergenic
996458450 5:123712258-123712280 TAATAATCACACAAAGAAGTGGG - Intergenic
996722493 5:126643637-126643659 CAGTAATAACACAAAAATGGGGG - Intergenic
998843909 5:146286292-146286314 CAACAGCAACAAAAAAAAGGTGG - Exonic
999275151 5:150325312-150325334 TAATAAGATCAGAAAGAAGGTGG - Intronic
1000114313 5:158138912-158138934 CAACAAGAACCCAAAGAAGCAGG - Intergenic
1002438076 5:179245460-179245482 CAAGAACAGTACAAAGATGGGGG + Intronic
1003544457 6:7047275-7047297 CAAAGACAACACAATGAATGTGG - Intergenic
1003769753 6:9286467-9286489 AAATAAAAACAAAAAGAAAGGGG + Intergenic
1004052763 6:12104278-12104300 AAGTAACAAAACAAAGAAGGTGG - Intronic
1004575825 6:16893123-16893145 CAATAACAGCAACAAGAATGTGG - Intergenic
1004809634 6:19246190-19246212 CAGTAACAACACAAAGGACCAGG + Intergenic
1004875493 6:19947770-19947792 CAATAATAAGACAAAAAATGAGG - Intergenic
1004976030 6:20967520-20967542 CAGTAACAACAAAAAGAAGTGGG - Intronic
1005007266 6:21300317-21300339 CAATTATAGCACAAAGGAGGAGG + Intergenic
1005115097 6:22327349-22327371 CATTAAGAACACAAATAAGCTGG + Intergenic
1005267459 6:24126822-24126844 GTCTAACAACACAAAGAAGTAGG - Intronic
1005351980 6:24945592-24945614 CAATAACAGCACAAAGAAGAGGG + Intronic
1005590122 6:27314678-27314700 TAATAACAGCACAAAGGAGGTGG + Intergenic
1005610109 6:27515391-27515413 CTATCAAAACACAAAGAAGCAGG - Intergenic
1007477816 6:42130622-42130644 CAATAACAACTGTAGGAAGGAGG - Intronic
1007507193 6:42344800-42344822 AAAAAATAAGACAAAGAAGGTGG - Intronic
1008344688 6:50412113-50412135 CAAGTACAACAAAAAGAGGGAGG + Intergenic
1008399393 6:51047232-51047254 CAATAACAAGTCAAAGATGTTGG + Intergenic
1010099455 6:72086992-72087014 AAATCACTACAGAAAGAAGGAGG + Intronic
1010263395 6:73841419-73841441 TAATAAGAACACACAGAAGATGG - Intergenic
1010346071 6:74812256-74812278 CAATAACAGCATAAAGGATGTGG + Intergenic
1010362718 6:75013328-75013350 AGATAAAAACACAAAGATGGGGG + Intergenic
1010928245 6:81769616-81769638 CAATGGCAACACAATGAAAGTGG + Intergenic
1010948937 6:82012178-82012200 CAATAACAACAACAACAAAGAGG + Intergenic
1012021289 6:93923720-93923742 CAACAACAACAAAAAGAAAATGG + Intergenic
1012065350 6:94543523-94543545 CAATAATAACAACAAGAAGAGGG + Intergenic
1012256730 6:97041284-97041306 CAATAACAACACACACAGGATGG - Intronic
1012267205 6:97160036-97160058 CAATAACAATAAAAAGGAGGTGG - Intronic
1012453987 6:99384060-99384082 CAATAACAACAAAAATGAGCTGG - Intronic
1012740402 6:103009028-103009050 CAACAACAACAAAAAGAAACTGG + Intergenic
1013008195 6:106094739-106094761 CAATAACAACAAAAATTAGCTGG + Intronic
1014228757 6:118878556-118878578 CAATAATAGCACAAAGAAAAGGG + Intronic
1014839181 6:126197731-126197753 CAATAAGGACACAAATATGGAGG + Intergenic
1015297002 6:131607135-131607157 CATTAACAAAAAAAATAAGGAGG + Intronic
1015569598 6:134607300-134607322 CAATATCAAAACCAAGAAGTTGG + Intergenic
1015616620 6:135082796-135082818 CAATAATAGCACAATGGAGGGGG + Intronic
1016161713 6:140889694-140889716 CAATGACATCACAAAGATAGGGG - Intergenic
1016228747 6:141775278-141775300 CAACAACAACAAAAAGCTGGAGG + Intergenic
1016283929 6:142451436-142451458 CAACAGCAACACAAAGAAAATGG - Intergenic
1016301222 6:142633831-142633853 CAACAACAACAAAAAAAAAGAGG + Intergenic
1016981240 6:149856500-149856522 AAATAACAACACGAAGAGGAAGG + Intronic
1017308777 6:152952586-152952608 CAATAGAAACATAAAGAAGTGGG + Intergenic
1017471098 6:154737521-154737543 CAACAACAACACAAATTAGCTGG + Intronic
1017631406 6:156399451-156399473 AAATATCAACACAATGAAGAAGG - Intergenic
1018230574 6:161671250-161671272 CACTGCCAACACTAAGAAGGAGG - Intronic
1018911916 6:168106208-168106230 CAACAACAACAAAAAAAGGGTGG + Intergenic
1019195977 6:170283421-170283443 CAAGAACACCAACAAGAAGGCGG - Exonic
1021204901 7:17768386-17768408 TAATAACAACCCGAAGATGGAGG - Intergenic
1021218162 7:17942043-17942065 AAATAAGAAAACAGAGAAGGAGG + Intergenic
1021246068 7:18262708-18262730 TAACAATAACACAAAGAAGAGGG + Intronic
1021434735 7:20601246-20601268 CAAAAACAACAAAAAGAGCGAGG - Intergenic
1021595228 7:22308773-22308795 CAATAACAATTCAAAGAGGATGG + Intronic
1021758696 7:23882031-23882053 CAAGAACAGCACCAAGAAGATGG + Intergenic
1023101815 7:36725800-36725822 CAAAAACAAGACACTGAAGGGGG - Intergenic
1023111451 7:36815429-36815451 CAATAAAAACACAAAGGGAGAGG + Intergenic
1023142515 7:37116301-37116323 CAATTACAGCAGAAAGAAAGAGG + Intronic
1024395815 7:48865359-48865381 CAATCAAAACACAAAGAAATAGG + Intergenic
1024399421 7:48906917-48906939 CAATCAAAACACAAAGAAATAGG - Intergenic
1024495311 7:50039589-50039611 CAGTAATAACACAAAAGAGGTGG + Intronic
1024601098 7:50982441-50982463 TAAAAACAGGACAAAGAAGGTGG - Intergenic
1024827660 7:53411446-53411468 CAACAACAACAAAAAAAAGTGGG - Intergenic
1025638386 7:63345057-63345079 CAATTACAGCACAGAGAAAGTGG - Intergenic
1025644310 7:63403032-63403054 CAATTACAGCACAGAGAAAGTGG + Intergenic
1025713898 7:63936102-63936124 CAATAACAGCACAGAGAAGGTGG + Intergenic
1025809026 7:64862199-64862221 AAATAACAACATAAGGGAGGAGG + Intergenic
1025838233 7:65116632-65116654 CAGTAACATCAAAAAGGAGGTGG + Intergenic
1026121328 7:67540524-67540546 CAAGAACAACAAAAAGAAGGTGG - Intergenic
1026833981 7:73625969-73625991 AAATAAAAATACAAAGAAGCAGG - Intergenic
1026924951 7:74184976-74184998 CAACAACAACAACAAAAAGGCGG - Intronic
1027310042 7:76946113-76946135 CAATAACAACACCAACAAAGAGG - Intergenic
1028666941 7:93356116-93356138 CAAGAACAGCACAAAGAAAAAGG - Intronic
1028931625 7:96419549-96419571 CAAAAAAAAAAAAAAGAAGGTGG + Intergenic
1029058066 7:97767461-97767483 CAATAACAGCAGAAGGAAGATGG - Intergenic
1029310461 7:99659191-99659213 AGATAAAAACACAAAGATGGGGG - Intronic
1029893244 7:103953951-103953973 CAATAACAACAAAAACAGGCGGG + Intronic
1030440039 7:109577867-109577889 CATCATCAACAGAAAGAAGGAGG - Intergenic
1030565949 7:111156017-111156039 CTATGACAACACAAAGAACATGG - Intronic
1030620495 7:111785052-111785074 CAATAACAAGAGAAAGAGGTAGG - Intronic
1030652604 7:112131779-112131801 CACTAATGACACAAAAAAGGAGG + Intronic
1031375906 7:121025672-121025694 GAGAAAGAACACAAAGAAGGAGG - Intronic
1031584693 7:123520386-123520408 AAATAATAAAGCAAAGAAGGTGG + Intronic
1031802958 7:126272424-126272446 TAATTACAACACTAAGAAGGAGG - Intergenic
1031819720 7:126485349-126485371 CAACAACAACAAAAAAAAAGGGG + Intronic
1033394516 7:140961133-140961155 CAGTAACAGCACAAAGGAGTAGG + Intergenic
1033683395 7:143618621-143618643 CAACAACAACGAAAATAAGGTGG - Intergenic
1033701218 7:143839017-143839039 CAACAACAACGAAAATAAGGTGG + Intergenic
1034987190 7:155523610-155523632 CAAGAACAACCCACAGAAGGTGG + Intronic
1035183199 7:157105769-157105791 CAACAACAACAACAACAAGGAGG - Intergenic
1035549661 8:510938-510960 CAATAACACCACAAAAGATGAGG + Intronic
1035959699 8:4123937-4123959 CAATTACAACTCAAAAAAGCTGG + Intronic
1036661302 8:10710833-10710855 CAATGACAGGACAAAGCAGGAGG + Intronic
1037235537 8:16715462-16715484 AAACAACAACAAAAAGAAGAAGG + Intergenic
1037714919 8:21389152-21389174 CAATAAAAATAAAAAGAATGAGG - Intergenic
1038264481 8:26027407-26027429 CAATACCCACACCAAGATGGTGG + Intronic
1038427826 8:27476111-27476133 CAACAACAACAAAATGAATGAGG - Intronic
1038514487 8:28174550-28174572 CAATAACAATACAGAGGGGGAGG - Intronic
1038741221 8:30218809-30218831 AAATAAAATCACAAAGAAAGTGG - Intergenic
1038809393 8:30824763-30824785 CCATAACAACCCTAAGAAGTAGG + Intergenic
1039210330 8:35205890-35205912 CACTAACAACATGAAGCAGGAGG - Intergenic
1039394384 8:37211567-37211589 CAATAATAGCACAAAGGAAGAGG + Intergenic
1039536677 8:38322234-38322256 CAAAAACAAAACAAAGTAGTGGG - Intronic
1039891222 8:41686847-41686869 CAATAACAATAAAAATAATGGGG - Intronic
1040122321 8:43696922-43696944 CAAAAACAAGAGACAGAAGGGGG - Intergenic
1040755958 8:50774797-50774819 CAATAATAACCCAAAGAAGTGGG + Intronic
1041609273 8:59825557-59825579 CAAAAACAACACAAAGGAAGTGG - Intergenic
1041950907 8:63500384-63500406 CAATAATAATACAAAGATAGAGG - Intergenic
1042367870 8:67957197-67957219 CAAAAGGAAAACAAAGAAGGAGG - Intronic
1042767159 8:72335218-72335240 AAATAATAACACAAAAAGGGAGG - Intergenic
1042808827 8:72801696-72801718 CAATAAGACCACCAAGGAGGAGG + Intronic
1042936801 8:74067503-74067525 CAAAAAAAACACATGGAAGGCGG - Intergenic
1043589555 8:81812859-81812881 CAATAGCAACACAAAGAAAGAGG + Intronic
1044058202 8:87599120-87599142 CAACAACAACAAAAATAAGCAGG + Intronic
1044359657 8:91267201-91267223 CAACAACAACAAAAAGAGGTGGG - Intronic
1044492320 8:92834104-92834126 CAGTAACAACAAAAAGAATAGGG - Intergenic
1045598600 8:103686921-103686943 CTAAAACCACACAAAGAAGCTGG - Intronic
1045892778 8:107177121-107177143 CAATAATAGCACAAAGAATTTGG + Intergenic
1046178213 8:110607079-110607101 CAACAACAACAAAAACAAGCAGG + Intergenic
1047072832 8:121366225-121366247 TAAGAACATCACAAAGAATGGGG - Intergenic
1047735626 8:127762550-127762572 CAAGAACAACAAGAGGAAGGAGG + Intergenic
1047794140 8:128236649-128236671 CAACAACAACACCAAGAGGCTGG + Intergenic
1047855677 8:128908425-128908447 CAATAACAACAAAAACAAATAGG - Intergenic
1048322587 8:133411894-133411916 CAACAACAACAAAATGAAGATGG - Intergenic
1048657952 8:136563222-136563244 TACTAAAAACACAAAAAAGGTGG + Intergenic
1049667962 8:143856460-143856482 CAAGAACAACAGGAAGAATGTGG + Intergenic
1049704054 8:144030930-144030952 CAATAATAACATAAAGGGGGAGG - Intronic
1050908242 9:11032512-11032534 ATATAACAGCACAAAGTAGGTGG - Intergenic
1052378574 9:27744819-27744841 CAACAACAACAAAAATAAAGAGG + Intergenic
1052583722 9:30395849-30395871 CAATAACAGCACAAAGAAGAGGG - Intergenic
1052959878 9:34286344-34286366 CAACAACAACAAAAAGAAACTGG + Intronic
1054790142 9:69248994-69249016 CAACAACAACAAACTGAAGGGGG + Intronic
1055203867 9:73702304-73702326 CAATAATAGCACAAGGAAGGAGG + Intergenic
1055615019 9:78062802-78062824 CAACAACAACAAAATGATGGGGG + Intergenic
1056006253 9:82274645-82274667 CAATGGGAACACAAAGGAGGAGG - Intergenic
1056594432 9:87994617-87994639 CAATAACAGCACAAAGGAGAAGG - Intergenic
1056703326 9:88930146-88930168 CAATGACAACAAAAATGAGGTGG - Intergenic
1057129784 9:92646087-92646109 CAATAACAGCACAAAGGTTGGGG + Intronic
1057296391 9:93845923-93845945 CAATAACAGCACAAAGGAGTGGG - Intergenic
1057718886 9:97517020-97517042 CTATAACAACAAAAAGATAGTGG + Intronic
1058018327 9:100062206-100062228 AAATTACAACCCAAAGAAGTGGG - Intronic
1058040994 9:100301835-100301857 TCACAAAAACACAAAGAAGGAGG + Intergenic
1058126005 9:101195719-101195741 GGAAAACAACACAAAGCAGGTGG - Intronic
1058676325 9:107403349-107403371 CTAGAACAACACACAGAAGTGGG + Intergenic
1059258839 9:112956448-112956470 CAACAACAACAACAAAAAGGCGG + Intergenic
1059258842 9:112956451-112956473 CAACAACAACAAAAAGGCGGGGG + Intergenic
1059387365 9:113974949-113974971 CATTGACAACACTATGAAGGAGG - Intronic
1059617712 9:115968649-115968671 CAAGAACAGCACCAAGAGGGTGG + Intergenic
1059680691 9:116582576-116582598 CAATAACAACAAAAAGTGGCTGG - Intronic
1060001585 9:119963680-119963702 CAATAAGCCCACAAAGAAGTTGG - Intergenic
1060332418 9:122685325-122685347 AAATAATCACACAAAGGAGGAGG + Intergenic
1060334282 9:122706696-122706718 CAAGAACAGCACCAAGAAGATGG + Intergenic
1060490861 9:124083241-124083263 CAACAACAACAAAAAAAAAGTGG + Intergenic
1060975881 9:127764686-127764708 CAACAACAACAAAGAGCAGGAGG - Intronic
1061610203 9:131740594-131740616 AAAAAACAAAACAAAAAAGGGGG - Intergenic
1061641864 9:131964593-131964615 TAAGAACAAGAGAAAGAAGGCGG + Intronic
1061738917 9:132684844-132684866 AAATAATAACGCAAGGAAGGAGG - Intronic
1061977816 9:134080557-134080579 CAACAACAACAACAAGAAAGTGG - Intergenic
1185469159 X:372324-372346 AAATATCAACAGAAAGAAGTGGG + Intronic
1185838736 X:3369099-3369121 CAATCACATCACAGAGAATGGGG + Intergenic
1186047327 X:5550486-5550508 CAACAACAACAAGAAGGAGGAGG - Intergenic
1186047328 X:5550489-5550511 CAACAACAACAACAAGAAGGAGG - Intergenic
1186160222 X:6769587-6769609 CCATGACAACACAAACAAGAAGG - Intergenic
1186413311 X:9362316-9362338 AAATAAAAACAAAAAGAAGCAGG + Intergenic
1186484233 X:9921456-9921478 CAATGACAACAAAAAAAAAGAGG - Intronic
1186594502 X:10966148-10966170 CAATAATAAAAAAAAGAAGTTGG + Intergenic
1186773497 X:12840379-12840401 CAACAACAACAAAAAGAAAATGG + Intergenic
1187039904 X:15582756-15582778 CAAAAAAAACAGAAAGAATGAGG + Intronic
1187058847 X:15766530-15766552 AAATAACAACGCAAAAAAAGGGG - Intronic
1187186593 X:16992563-16992585 CAATAAAAACATAAGGAAGGTGG - Intronic
1187234458 X:17454057-17454079 CAATAACAATACAAACATGTGGG - Intronic
1187625517 X:21108461-21108483 CAATGACAAGACAAAGAAAAAGG - Intergenic
1187852355 X:23603646-23603668 TGCTAACAACACAAAGAATGAGG + Intergenic
1188345904 X:29065023-29065045 CAACAACAAAACAAATGAGGTGG - Intronic
1188468553 X:30510898-30510920 CCTTAACAACACAAAGAACAAGG + Intergenic
1188698332 X:33225932-33225954 CAAAGACAACACATAGATGGCGG + Intronic
1188997508 X:36904188-36904210 CAACAACAACAGAAAAAATGTGG + Intergenic
1189298062 X:39932983-39933005 CAACAACAACAAAAAGAAGTTGG + Intergenic
1189422246 X:40866537-40866559 CATTAACACAGCAAAGAAGGGGG - Intergenic
1189555415 X:42139844-42139866 TAATAATATCACAAAGGAGGAGG - Intergenic
1189878745 X:45466716-45466738 CAACAACAACAAAAAGAAAAGGG + Intergenic
1189925560 X:45950498-45950520 CAAAAACAACATAAGGGAGGGGG - Intergenic
1190418141 X:50201057-50201079 CAGTGACAGCACAAAGATGGAGG + Intergenic
1190467619 X:50742154-50742176 CAATAATAGCACAAAGCAGGGGG - Intronic
1190538409 X:51452649-51452671 CAATAACAGAACAAAAAAGGAGG - Intergenic
1191035589 X:56023097-56023119 CAATTACAACACAAAAGATGGGG + Intergenic
1191964090 X:66737340-66737362 CAAAAACAAAACAAAGGTGGAGG - Intergenic
1192466457 X:71360031-71360053 AAACAACAACAAAAAGAAAGCGG - Intergenic
1193381139 X:80817628-80817650 CAATAACAGCAAAAAGAAGATGG + Intergenic
1193381202 X:80818203-80818225 CAATAACAAAACAAAAAGGAAGG + Intergenic
1193734454 X:85140351-85140373 CCATAACAACCCTAAGAGGGTGG + Intergenic
1194113207 X:89863825-89863847 CTAACATAACACAAAGAAGGTGG - Intergenic
1194621126 X:96173908-96173930 CAATACCAAAAAAAAAAAGGAGG - Intergenic
1194626870 X:96235564-96235586 CAATTAGAACAAAAAGATGGAGG + Intergenic
1194867884 X:99091149-99091171 CAAAAACAACATAAAAAAGTAGG + Intergenic
1195204999 X:102589577-102589599 CAATGATAACACAAAGGAAGGGG - Intergenic
1195284035 X:103365476-103365498 CAATAACAGAACAAAAAAGGTGG - Intergenic
1195847859 X:109248131-109248153 AGATAAAAACACAAAGATGGGGG - Intergenic
1196354127 X:114769703-114769725 CAATGATATCACAAAGAAGGGGG - Intronic
1197676164 X:129333001-129333023 TAATAATGACACAAAGGAGGAGG - Intergenic
1197811899 X:130452621-130452643 AAATAAAACCACAAAGATGGGGG - Intergenic
1198303730 X:135358503-135358525 CAATAACAGCAGAAATGAGGTGG - Intronic
1198475042 X:136987795-136987817 CAATGACAGCACAAAGGAGGGGG - Intergenic
1198482491 X:137053483-137053505 CATTAAGAACACAGAGAAGGGGG - Intergenic
1198581386 X:138068636-138068658 CAATAACAGCAGAAAGAATGGGG - Intergenic
1198927966 X:141821034-141821056 CAATAGGGACACAAAAAAGGTGG - Intergenic
1199089586 X:143676005-143676027 CAACAACAACGACAAGAAGGAGG - Intergenic
1199146318 X:144372312-144372334 CAATAACAGCCCAAAGATGGAGG - Intergenic
1199621164 X:149702961-149702983 CAATAGCAACACAAAGAAGTAGG - Intronic
1200328688 X:155270745-155270767 CAAAAGCAACACAAAAGAGGTGG - Intergenic
1200465893 Y:3518884-3518906 CTAACATAACACAAAGAAGGTGG - Intergenic
1201171977 Y:11275854-11275876 TAATAAAAAAAAAAAGAAGGAGG + Intergenic
1201237051 Y:11921806-11921828 CAATCACATCACAGAGAATGGGG - Intergenic
1201752818 Y:17452220-17452242 CAATAAAAAAACAAAATAGGAGG - Intergenic
1202628445 Y:56884007-56884029 CAACAACTACAAAAAAAAGGTGG + Intergenic