ID: 1170669219

View in Genome Browser
Species Human (GRCh38)
Location 20:18415323-18415345
Sequence CGGCTGGTGTGGAGCCATGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170669219_1170669229 23 Left 1170669219 20:18415323-18415345 CCACCATGGCTCCACACCAGCCG 0: 1
1: 0
2: 3
3: 20
4: 214
Right 1170669229 20:18415369-18415391 CCAGCGACCACATCTGTAGCAGG 0: 1
1: 0
2: 1
3: 4
4: 85
1170669219_1170669230 29 Left 1170669219 20:18415323-18415345 CCACCATGGCTCCACACCAGCCG 0: 1
1: 0
2: 3
3: 20
4: 214
Right 1170669230 20:18415375-18415397 ACCACATCTGTAGCAGGAAATGG 0: 1
1: 0
2: 0
3: 15
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170669219 Original CRISPR CGGCTGGTGTGGAGCCATGG TGG (reversed) Exonic
900050685 1:593736-593758 AGGCAGGCGTGGAGCCTTGGAGG - Intergenic
900291605 1:1926075-1926097 CGGCTGGTGTGAGGGCCTGGGGG + Intronic
900467477 1:2832896-2832918 GGGCGGGTGAGGAGCCATGGTGG - Intergenic
900624966 1:3603824-3603846 CGGCTGGCCTGGGGCCAGGGTGG - Intronic
900888314 1:5430938-5430960 CGGCAGGTGTGGGGGGATGGTGG - Intergenic
901594476 1:10373841-10373863 TGGGTGGGGTTGAGCCATGGGGG - Intronic
902404481 1:16175236-16175258 CTCCGGGTGTGGAGCTATGGTGG + Intergenic
902577897 1:17389856-17389878 CGGCCGGTGTGGAGCGAGTGGGG - Intronic
903285162 1:22272576-22272598 TGGCTGGAGTGAAGCCACGGAGG + Intergenic
904438194 1:30512909-30512931 CAGCTGGTGTGGAGCAGAGGTGG - Intergenic
904567404 1:31435877-31435899 CTGGTAGTGGGGAGCCATGGAGG + Intergenic
905012303 1:34755624-34755646 CAGGTGGTGTGGAGACAGGGTGG + Intronic
905214033 1:36394123-36394145 CAGCTGGTGTGGAAGAATGGCGG - Exonic
905569173 1:38990938-38990960 GGCCTGGTGAGGGGCCATGGGGG - Intergenic
912510338 1:110185379-110185401 CTGCTGGTGTGGAGCCAGCCGGG - Intronic
913044470 1:115062158-115062180 CGGGTGCTGCGGAGCCATGCGGG - Exonic
914196638 1:145451253-145451275 AGGCTGGTGTGGAGCTATGGAGG - Intergenic
916420580 1:164634308-164634330 CAGCTGGTGTGGGGCCAGGCAGG - Intronic
917567687 1:176229814-176229836 GGGCTGGTGTGTGGCCATAGGGG - Intergenic
918406110 1:184213276-184213298 AGGCTGGTGTGGAGCCAACTGGG - Intergenic
918647013 1:186917060-186917082 CGGCTGTGGTGGATCCAGGGTGG + Intronic
919578124 1:199337160-199337182 AGGCTGGTGTGCAGCTATAGGGG - Intergenic
920035400 1:203061870-203061892 TGGCAGGTGAGGAGCCCTGGAGG + Intronic
921126112 1:212179575-212179597 AGGCTGGGGTGGTGGCATGGGGG - Intergenic
921404618 1:214765159-214765181 GGGCTGGTGTGTGGCCATGGGGG + Intergenic
922036239 1:221851323-221851345 CAGCTGGTGAGGAGACCTGGGGG + Intergenic
923012139 1:230096203-230096225 CAGCTGAGGTTGAGCCATGGTGG + Intronic
924331668 1:242946242-242946264 GGGCTGGTGAGTGGCCATGGGGG - Intergenic
1062799542 10:368958-368980 GGGCTGGTGGGGAGGCACGGCGG + Intronic
1062948134 10:1476232-1476254 AGCCTGGAGTGGAGCCAGGGGGG + Intronic
1065754548 10:28919190-28919212 GGGCTTGTGAGGCGCCATGGTGG - Intergenic
1067722917 10:48743243-48743265 GGGCTGTTTTGGAGCCCTGGAGG + Exonic
1071379206 10:85040910-85040932 CTGATGGTGTAGAGACATGGAGG - Intergenic
1075070762 10:119318635-119318657 CGGCTGGGGTGCAGCGATGATGG - Intronic
1076346175 10:129780276-129780298 AGGCTGCAGTGGAGCCATCGTGG + Intergenic
1076591331 10:131585873-131585895 GGGCAGGTGTGGAGCAATGGTGG + Intergenic
1076829462 10:132986693-132986715 CTGCTGGTCTGGTGCCCTGGAGG - Intergenic
1078450650 11:11438109-11438131 AGGCTGGAGTGAGGCCATGGTGG - Intronic
1079404368 11:20131889-20131911 CGGCATGTGTGGCTCCATGGAGG + Intergenic
1080923347 11:36730968-36730990 GTGCTGTTGTGGGGCCATGGTGG + Intergenic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083719975 11:64599234-64599256 TGCCTGGTGTGGGGCCAGGGAGG + Intronic
1084322153 11:68379317-68379339 CTGTTCTTGTGGAGCCATGGTGG + Intronic
1084661053 11:70546648-70546670 GGGCTGGTGTAGACCCCTGGTGG + Intronic
1085279411 11:75320273-75320295 GGGCTGGAGTGGAGCCAGGCTGG + Intronic
1087780009 11:102291706-102291728 CAGCAAGTGTGGAGCCCTGGAGG - Intergenic
1087868930 11:103267004-103267026 CAGCTGATGTGGAGCCCAGGGGG - Intronic
1090162537 11:124510546-124510568 GGGCTGGTGTGTGGCCATAGAGG + Intergenic
1090355819 11:126139766-126139788 GGGCTGGGAAGGAGCCATGGAGG - Intergenic
1090414415 11:126530775-126530797 CCCCTGGTGTGAAGCCTTGGCGG + Intronic
1090740417 11:129654585-129654607 GGGCTGGTGTATGGCCATGGGGG - Intergenic
1091763855 12:3105481-3105503 AGGCTGGGGTGGAGCAAGGGAGG + Intronic
1092657459 12:10702044-10702066 CGGCTGGTTTGGACCACTGGTGG + Exonic
1096836660 12:54355608-54355630 CAGCTGGTGGGCAGGCATGGGGG - Intergenic
1098028510 12:66230702-66230724 GGGGCGGTGTGGAGTCATGGTGG + Intronic
1099732802 12:86526457-86526479 CAGCTGGTGTGTGGCCATGAGGG + Intronic
1102506461 12:113387490-113387512 TGGCTGGGGTGGTGGCATGGAGG + Intronic
1102567305 12:113805136-113805158 CGGCTGTTGAAGAGCCCTGGGGG + Intergenic
1106479264 13:30124394-30124416 AGGCTGGTGTGGTGCCTGGGTGG - Intergenic
1107353469 13:39541177-39541199 CAGCTGGAGTGGAGAGATGGAGG - Intronic
1107940143 13:45375979-45376001 AGGCTGGGGTGGTGCCATGTTGG - Intergenic
1111691761 13:91572667-91572689 TGGATGGTGTTGAGTCATGGGGG - Intronic
1113766208 13:112882431-112882453 AGGGTGAGGTGGAGCCATGGTGG + Exonic
1115961378 14:38838241-38838263 GGGCTCCTGTGGAGCCAGGGTGG + Intergenic
1116015822 14:39405496-39405518 GGGGGGGTGTGGAGGCATGGTGG + Intronic
1117066891 14:52019953-52019975 AGCCTGGTCTGGAGCCTTGGTGG - Intronic
1117223167 14:53627705-53627727 GGGCTGGTGGGGAGTCAGGGAGG + Intergenic
1119432843 14:74579517-74579539 GGGCTCCTGTGGAGCCGTGGAGG + Intronic
1119602007 14:75982641-75982663 CGGCTGGTCGGGAGCCGGGGAGG + Intronic
1121515706 14:94548520-94548542 AGGCTGGGCTGGAGCCATGGTGG + Intergenic
1122277729 14:100603817-100603839 GTGCAGGGGTGGAGCCATGGGGG + Intergenic
1122983357 14:105201421-105201443 AGGCTGGAGCAGAGCCATGGGGG + Intergenic
1123054434 14:105562354-105562376 CGGCTGGTGTGGGAGCCTGGGGG + Intergenic
1123079018 14:105682773-105682795 CGGCTGGTGTGGGAGCCTGGGGG + Intergenic
1124193668 15:27601475-27601497 TAGCTGGTGTGGATCCATGCGGG + Intergenic
1125755387 15:42060722-42060744 CAGCTTGTTTGGAGCCAAGGGGG - Intergenic
1126466081 15:48962812-48962834 CGGCAGGTGAGGTGCCAGGGCGG + Exonic
1127188711 15:56507063-56507085 GGGCTGGTGTACAGCCATAGTGG - Intergenic
1127324925 15:57885675-57885697 TGGCCGGGGTGGAGGCATGGTGG + Intergenic
1130123115 15:81069370-81069392 TGGCTGGAGTGGAGCGAGGGGGG + Intronic
1130863328 15:87910060-87910082 TGGCTGGGATGGAGCCAAGGGGG + Intronic
1132110616 15:99099776-99099798 CTGCTGGTGTGGCCCCATGCTGG + Intronic
1133082923 16:3337937-3337959 CAGCTTGTGGGGAGGCATGGGGG - Intergenic
1134029781 16:10982573-10982595 CGGCTGAAGTGGAGCAATGCGGG - Intronic
1135413192 16:22250423-22250445 CAGCTGGGGTGGAGGAATGGGGG + Intronic
1136019556 16:27431289-27431311 CGCCAGATGTGGAGCCATGGTGG - Intronic
1136402138 16:30024796-30024818 CGGGTGATGGGGAGCCCTGGGGG + Exonic
1136450971 16:30354112-30354134 CTGGTGGTGTGGAGCGAGGGAGG - Intronic
1136641370 16:31568534-31568556 CGGCTGGTTTGGACCACTGGAGG + Intergenic
1137272960 16:46914849-46914871 CTGCTGGTGTGCAGTAATGGGGG + Intronic
1138289341 16:55833392-55833414 CTGCTGGTGTGGGCCCTTGGGGG - Intergenic
1141030851 16:80587086-80587108 TGGCTGGTGTGCACCCCTGGAGG - Intergenic
1141182800 16:81765857-81765879 CAGCTGCTGTGTAGCCAAGGTGG + Intronic
1142356244 16:89603514-89603536 GGGCTGGAGGGGAGCCCTGGGGG + Intergenic
1142356279 16:89603596-89603618 GGGCTGGAGGGGAGCCCTGGAGG + Intergenic
1142356297 16:89603637-89603659 GGGCTGGAGGGGAGCCCTGGGGG + Intergenic
1142356351 16:89603758-89603780 GGGCTGGAGGGGAGCCCTGGAGG + Intergenic
1142356484 16:89604119-89604141 GGGCTGGAGGGGAGCCCTGGGGG + Intergenic
1142375235 16:89703155-89703177 GGACTGGTGTGGACCCATGGTGG - Intergenic
1143038463 17:4015096-4015118 CAGCTGGTGTGGAGCAAGGCTGG + Intronic
1143088757 17:4436045-4436067 TGGCTGCTGTGGACCCAGGGAGG + Intronic
1147371827 17:39997736-39997758 CGGCTGGGGAGGAGCCCTGGGGG - Exonic
1151244425 17:72783630-72783652 TGGATGGTGTGAAGCCGTGGGGG + Intronic
1151743633 17:76000516-76000538 TGCTTGGTGTGGGGCCATGGAGG + Exonic
1152284945 17:79406930-79406952 AGGCTGCTGGGGAGCTATGGTGG + Intronic
1152460501 17:80439735-80439757 CGGCTGGTGTGGGGCCAGTAGGG + Intergenic
1153063499 18:1018695-1018717 CAGGGGGTGAGGAGCCATGGGGG + Intergenic
1153117199 18:1673456-1673478 GGGCTGGTGGAGAGACATGGGGG + Intergenic
1155070125 18:22307749-22307771 TGGCAAGTGTGGAGCCCTGGAGG + Intergenic
1161921360 19:7268511-7268533 AGGATGATGGGGAGCCATGGTGG - Intronic
1163267428 19:16229355-16229377 CGGCTGGTGCGGAGCTCTGGAGG - Intronic
1163447173 19:17353505-17353527 TGGCTGGAGTGGAGTGATGGAGG - Intronic
1165730733 19:38143129-38143151 AGGCTGGTGGGGAGCCATGGAGG - Intronic
1165900008 19:39164974-39164996 AGGCTGGTGTACAGCCATTGGGG + Intronic
1167016348 19:46843373-46843395 AGGCTGGTCTTGAACCATGGAGG - Intronic
1167286505 19:48601400-48601422 AGGCTGGGGTGGGGCCCTGGGGG + Intronic
1168414404 19:56159542-56159564 AGGCTGGGGTGGAGGCAGGGAGG - Intronic
925035277 2:680247-680269 CGGCTGGCATGGGGCTATGGAGG - Intergenic
925409445 2:3631617-3631639 CGGCTGGTGGGGAGTTAGGGTGG - Intronic
925656536 2:6156027-6156049 GGGGTGGGGTGGGGCCATGGTGG - Intergenic
926214041 2:10892762-10892784 CAGCGTGTGAGGAGCCATGGCGG + Intergenic
926830639 2:16958507-16958529 CTGTGGGTCTGGAGCCATGGAGG - Intergenic
928313737 2:30231113-30231135 CGGCTGGGGTGGAGGAGTGGCGG + Intergenic
930028706 2:47045325-47045347 GAGCTGGGGTGGAGCCCTGGAGG - Intronic
933929460 2:87134068-87134090 TGTCTGTTTTGGAGCCATGGGGG - Intergenic
934000791 2:87709860-87709882 TGTCTGTTTTGGAGCCATGGGGG - Intergenic
936093870 2:109517274-109517296 GGGCTGGTGTGGAGACAAAGGGG - Intergenic
936363476 2:111829316-111829338 TGTCTGTTTTGGAGCCATGGGGG + Intronic
943153125 2:184138781-184138803 CAGCTGGTGTGGAGCCCAGAGGG - Intergenic
945761438 2:213920526-213920548 AGGCTGGTGTGTGGCCATGGGGG + Intronic
948446587 2:238038233-238038255 AGGCTGGTGTGCTGCCAAGGAGG + Intronic
948454995 2:238100749-238100771 TGGCTGGGGTGGAACCAGGGAGG + Intronic
1168845418 20:941218-941240 TGGCTGGAGTGGAGTGATGGGGG + Intergenic
1168908193 20:1423503-1423525 AGGGTGATGGGGAGCCATGGAGG + Intergenic
1170669219 20:18415323-18415345 CGGCTGGTGTGGAGCCATGGTGG - Exonic
1174158051 20:48529325-48529347 GGGTTGGTGTGGGGCTATGGTGG - Intergenic
1174483903 20:50849457-50849479 GGGCTGGAGGGGAGCCAGGGTGG + Intronic
1174561318 20:51432599-51432621 CTGCTGGCAGGGAGCCATGGTGG + Exonic
1175819700 20:61902175-61902197 CGGCAGGCGTGGAGGCATCGTGG + Intronic
1175936731 20:62517648-62517670 AGGCTGTTGTGGGGGCATGGGGG - Intergenic
1175939466 20:62531380-62531402 GGGGTGGCGGGGAGCCATGGGGG - Intergenic
1176189816 20:63803107-63803129 CTGCTGGTGAGGTGCCCTGGGGG - Intronic
1176189844 20:63803192-63803214 CTGCTGGTGAGGCGCCCTGGGGG - Intronic
1179965359 21:44801742-44801764 CAGCTGTTGCGGGGCCATGGCGG - Exonic
1179978346 21:44883520-44883542 AGGCTGCTGTGCAGCCAGGGTGG - Intergenic
1180954588 22:19736017-19736039 GGGCTGTTGTGGGGCCATGGGGG + Intergenic
1181035588 22:20168409-20168431 GGGCTGGTGGCGAGCCATGATGG - Intergenic
1181458141 22:23070908-23070930 CGGCTGATGCGGAGCCCGGGCGG + Intronic
1181471460 22:23142819-23142841 AGACTAGTGGGGAGCCATGGAGG - Intronic
1184554901 22:45227833-45227855 CGGCTGGGGCGGATCCATCGGGG + Intronic
1185164086 22:49247696-49247718 CGGAAGGAGTGGAGCCCTGGCGG - Intergenic
1185207413 22:49548058-49548080 CGGCAGGTGTGGGACCCTGGAGG - Intronic
1185274268 22:49943650-49943672 GGGCTGGTGTGGGGCGCTGGGGG - Intergenic
949775045 3:7623239-7623261 AGGATGATGTGCAGCCATGGAGG + Intronic
949814219 3:8040923-8040945 CTGTTGGTGTGGGGGCATGGTGG + Intergenic
950138559 3:10600105-10600127 GGGCTGGTGGGGGGCCATGGGGG + Intronic
954198833 3:49012372-49012394 TGCTTGGTGTGGAGCCATGAAGG + Exonic
954486742 3:50860139-50860161 TGTCTGGTGATGAGCCATGGGGG + Intronic
954594843 3:51815590-51815612 AGGCTGCAGTGGAGCCCTGGGGG - Intergenic
959421588 3:106135682-106135704 GGGCAGGTGCGTAGCCATGGGGG - Intergenic
961606635 3:128100318-128100340 CTGCTGGAGTGAAGCCATGGAGG + Intronic
962335625 3:134527659-134527681 AGGCTGGTGCATAGCCATGGGGG + Intronic
966320832 3:178699471-178699493 AGGCTGGTGTGAGGCCATAGGGG + Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
969197744 4:5576635-5576657 CGGCCTATGTGGAGGCATGGAGG - Intronic
974603777 4:64122729-64122751 AGGCTGGTGCGTGGCCATGGGGG + Intergenic
977979796 4:103307851-103307873 CGGCTGGGGGAGAGTCATGGGGG + Intergenic
980988505 4:139718392-139718414 AGGCTGGTGTGGAGGCAAGGAGG + Exonic
983277417 4:165635517-165635539 GTGCTGTTGTGGAGGCATGGCGG + Intergenic
984144487 4:176044386-176044408 AGGCTGGTGTGTGGCCACGGGGG + Intergenic
986754632 5:10824009-10824031 GGGCTGGTGTGTGGCCATGGGGG + Intergenic
988035622 5:25823694-25823716 CTGCTTGTGGGGAGGCATGGAGG - Intergenic
993809688 5:92460345-92460367 TGGGTGGTTTGGAGCCATGTTGG - Intergenic
994871022 5:105350799-105350821 CTGCTGTTGTGGGGGCATGGTGG - Intergenic
996663075 5:126027117-126027139 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
996954325 5:129164674-129164696 CAGCTGATGTGGAGCCCAGGGGG - Intergenic
997523331 5:134537176-134537198 GGGCTGGTGGGGAGCCTTGCAGG - Intronic
999462583 5:151770540-151770562 CTGCGGGAGTGGAGCCCTGGGGG + Exonic
1002103758 5:176869863-176869885 TGGGTGGGATGGAGCCATGGGGG - Intronic
1002420788 5:179148056-179148078 CTGCGAGTGGGGAGCCATGGAGG - Intronic
1002926633 6:1609210-1609232 CGGCTGGGGAGGGGTCATGGAGG + Intergenic
1003094100 6:3129069-3129091 CTGCTGGGGTGGAGTGATGGGGG + Exonic
1005213659 6:23499116-23499138 GGGCAGGTGTGCAGCCCTGGAGG - Intergenic
1006397704 6:33797858-33797880 CTGCTGAAGTGGAGCCTTGGGGG - Intronic
1007098529 6:39229105-39229127 CGGCCGCTCGGGAGCCATGGTGG - Exonic
1007410215 6:41657142-41657164 TGGCAGCTCTGGAGCCATGGAGG - Intergenic
1007711276 6:43825851-43825873 CAGGTGGTGTGGAGCTCTGGGGG + Intergenic
1008002630 6:46376641-46376663 AGGCTGGTGTGCAGCCACAGTGG - Intronic
1009741870 6:67757636-67757658 GGGCTGAACTGGAGCCATGGTGG - Intergenic
1011792730 6:90915692-90915714 CAGCCGGTGTGGAGCCCTTGTGG + Intergenic
1012339744 6:98105020-98105042 GGACTGGTGTGCAGCCATAGGGG + Intergenic
1013737889 6:113248772-113248794 TGGCTGGTGTGTGGTCATGGGGG - Intergenic
1015660122 6:135566103-135566125 GGGCTGGTGTGCTGCCATGTGGG + Intergenic
1017523238 6:155220408-155220430 AGGCTGGTCTGGAGGCCTGGCGG + Intronic
1019199868 6:170305981-170306003 TGGCTGCTGTGGATACATGGTGG - Intronic
1019599303 7:1873455-1873477 GGGCAGGTGGGGAGCCCTGGTGG + Intronic
1019705774 7:2496552-2496574 AGGCCAGTGTGGAGCCAAGGTGG - Intergenic
1021761321 7:23905094-23905116 CGGCTTGCGGGGAGGCATGGAGG - Intergenic
1022646235 7:32230723-32230745 CAGCTGGTTAGGAGCCATGGAGG + Intronic
1027539944 7:79453877-79453899 CGCCGGGTGGGGAGCCACGGAGG + Intergenic
1028762253 7:94509672-94509694 CGGCTGCGGCAGAGCCATGGGGG - Intronic
1032480524 7:132242845-132242867 TGGCTGGTGTGGAGCCAGTGTGG - Intronic
1033270641 7:139930053-139930075 CGGCTGGAGGGGAGGGATGGAGG - Intronic
1034538914 7:151743796-151743818 TGGCTGTTCTGGAGCCAGGGAGG + Intronic
1035499230 8:78406-78428 AGGCAGGCGTGGAGCCTTGGAGG - Intronic
1037373606 8:18205737-18205759 AGGCTGGTGCGTAGGCATGGGGG + Intronic
1037710135 8:21348735-21348757 CAGCAGGTGTGTAGCCTTGGAGG + Intergenic
1038982359 8:32773781-32773803 TGTCAGGTGGGGAGCCATGGAGG - Intergenic
1044127331 8:88474455-88474477 GGGCTGGTGTGCAGCCATAGGGG - Intergenic
1044873505 8:96642624-96642646 CTGGTGGTGTGGAGTCATGAGGG + Intergenic
1048936735 8:139363879-139363901 AGGCTGGTGTGGAGTCAGAGAGG - Intergenic
1048995865 8:139793404-139793426 CTGCTGGGGTGGAGCCCTGTGGG - Intronic
1049128095 8:140810534-140810556 GGGCTGGTGTGTGGCAATGGAGG - Intronic
1049537411 8:143188782-143188804 CGGCTGGGGAGGGGCCATGAAGG + Intergenic
1049601432 8:143509574-143509596 AGGCTTGTGGGAAGCCATGGTGG - Intronic
1049692168 8:143966211-143966233 GGGCAGCTGTGCAGCCATGGGGG - Intronic
1050424817 9:5502131-5502153 GGGCTGGTGTGTGTCCATGGGGG - Intergenic
1051116267 9:13697847-13697869 AGGCTGGTGTGTAGCCACAGGGG + Intergenic
1051920545 9:22259034-22259056 GGGCTGGTGCATAGCCATGGGGG - Intergenic
1057108567 9:92445089-92445111 CAGCTGGTGTGGAGCCCAGAGGG - Intronic
1060152871 9:121299857-121299879 GGGGCGGTGCGGAGCCATGGTGG - Exonic
1061129892 9:128702900-128702922 CGGCCGGAGCGGCGCCATGGAGG + Exonic
1062054292 9:134462983-134463005 CTGCTGGTGTGGTGGGATGGGGG + Intergenic
1062459086 9:136655376-136655398 GAGCTGGTGTGGAGACATGCAGG + Intergenic
1062494893 9:136827025-136827047 GGGCTGGTGTGGAGGCCTGTGGG + Intronic
1062698094 9:137885581-137885603 AGGCTGGTGTGGAGCTATGGAGG + Intronic
1185922718 X:4112165-4112187 TGGGAGGTGTGGAGTCATGGAGG - Intergenic
1186174305 X:6908891-6908913 CTTCTGGTGTCTAGCCATGGAGG - Intergenic
1187425708 X:19175740-19175762 GGGCTGGTGTGGTCCCCTGGAGG + Intergenic
1188492997 X:30755821-30755843 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
1189010802 X:37043827-37043849 GGGCTGGTGCGGAGCCATGCGGG + Intergenic
1191654926 X:63586087-63586109 GGGCTGGTGTACAGCCATAGGGG + Intergenic
1192497244 X:71623974-71623996 TGGCTGGGCTGGAGCCATAGAGG + Intergenic
1192738911 X:73874758-73874780 TGTCTGGTGGGGAGCCATGGAGG - Intergenic
1193883844 X:86960593-86960615 GTGCTAGTGTGTAGCCATGGGGG + Intergenic
1193960088 X:87914581-87914603 AGGCTGGTGTGTGGCCATAGGGG - Intergenic
1197404267 X:126030099-126030121 TGGCTGGTGCGTAGCCATGGGGG + Intergenic
1201229005 Y:11845407-11845429 GGGCTGGTGAGTGGCCATGGGGG - Intergenic