ID: 1170676129

View in Genome Browser
Species Human (GRCh38)
Location 20:18482550-18482572
Sequence GCATACAGCTTAGAAGTAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170676123_1170676129 17 Left 1170676123 20:18482510-18482532 CCTTAAAAGTGAGGGAGCTTAGG 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1170676129 20:18482550-18482572 GCATACAGCTTAGAAGTAACCGG 0: 1
1: 0
2: 0
3: 11
4: 135
1170676122_1170676129 18 Left 1170676122 20:18482509-18482531 CCCTTAAAAGTGAGGGAGCTTAG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1170676129 20:18482550-18482572 GCATACAGCTTAGAAGTAACCGG 0: 1
1: 0
2: 0
3: 11
4: 135
1170676121_1170676129 19 Left 1170676121 20:18482508-18482530 CCCCTTAAAAGTGAGGGAGCTTA 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1170676129 20:18482550-18482572 GCATACAGCTTAGAAGTAACCGG 0: 1
1: 0
2: 0
3: 11
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170676129 Original CRISPR GCATACAGCTTAGAAGTAAC CGG Intronic
900768181 1:4519512-4519534 GCAGACAGCTTAGAAGAAAGTGG + Intergenic
900914377 1:5624537-5624559 GTATTCAGCTGAGAAGTGACTGG + Intergenic
902195253 1:14793396-14793418 CCATGCAGCTTAGAAGTTAGGGG + Intronic
906868043 1:49444640-49444662 GCATATAGACTAGAAGTAAAGGG - Intronic
908389064 1:63669112-63669134 GCATACAGTTTAGCAGTGCCAGG - Intergenic
908431677 1:64064605-64064627 GCAGACAGCCTTGAAGAAACAGG + Intronic
909314527 1:74198447-74198469 GCCTACAGATGAGAAGTAAACGG - Intronic
911454126 1:98101969-98101991 GCATACAATTTACAAGTGACAGG + Intergenic
911703999 1:100989712-100989734 GAATATAACTTAGAGGTAACTGG - Intronic
912230887 1:107790990-107791012 AAATACAGCTTAGAAATAAGTGG - Intronic
912333585 1:108842408-108842430 GAATACAGCTTAAAATTATCTGG + Intronic
914853807 1:151335368-151335390 GCAGACAGATGAGAGGTAACAGG - Intergenic
916287604 1:163127705-163127727 GAATACAGCTCAGAAGTAAGGGG + Intronic
920209568 1:204318391-204318413 CCACACAGCTAAGAAGTAGCAGG + Intronic
921658180 1:217766022-217766044 GCATATAGATTAAAAGTAAAGGG - Intronic
922744244 1:228035459-228035481 GCATACAGTTTAGGAATCACTGG + Intronic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1066511348 10:36100474-36100496 ACATATAGATTACAAGTAACAGG + Intergenic
1068794621 10:61065124-61065146 GCATACAGTTTTGAAATCACTGG - Intergenic
1068844745 10:61659203-61659225 GATTACAGATTAGAAGTAGCTGG - Intergenic
1072460785 10:95616839-95616861 TCACACAGCTTATAAATAACAGG + Intronic
1073174535 10:101545366-101545388 ACATACACCTTAAAAGTAAATGG + Intronic
1074692315 10:116017248-116017270 ACATAAAGCTTAGAAGCAATAGG - Intergenic
1075251521 10:120880361-120880383 AGAAACAGCTTAGAAGGAACTGG + Intronic
1076892125 10:133290115-133290137 GCCCACAGTTGAGAAGTAACTGG - Intronic
1078342309 11:10506802-10506824 GCACACAGCTAATAAGTAATAGG + Exonic
1083090727 11:60197473-60197495 TCATACAGCTTACAACTACCTGG - Intergenic
1084488197 11:69463379-69463401 GCATGCTCCTTAGAAGGAACTGG - Intergenic
1084865719 11:72055367-72055389 TCATACAGCTAAAAAGCAACCGG + Intronic
1087234870 11:95706703-95706725 TCAAACAGCTTGTAAGTAACAGG + Intergenic
1087304388 11:96472163-96472185 GAATTCAGCTGAGAAGTGACAGG + Intronic
1088784747 11:113171217-113171239 GCATACAGCTCTTAAGTAAGTGG + Intronic
1089109971 11:116047770-116047792 TCATTCAGCTTATAGGTAACGGG - Intergenic
1091953146 12:4612381-4612403 GCATATAACTTAAAAGTACCTGG - Intronic
1094091856 12:26659318-26659340 CCAAACAGCTTACAAATAACAGG + Intronic
1099878262 12:88435737-88435759 CCATACTGCTTAAAAGTAAAAGG + Intergenic
1100284030 12:93147380-93147402 GAATTCAGCTAAGAAGAAACAGG + Intergenic
1101510941 12:105391725-105391747 GCATACAGCAGAGATCTAACTGG + Intronic
1101761944 12:107665833-107665855 GCATACAACTGAGAAGTATCAGG - Intergenic
1102778792 12:115545093-115545115 GCAAACAGCTTAGTTGTAAATGG + Intergenic
1103213545 12:119184146-119184168 TCACACAGCTTGGAAGTGACTGG - Intronic
1105720721 13:23111423-23111445 GCAGACAGCTTTTAAGTGACAGG + Intergenic
1106759644 13:32856238-32856260 GCAGACAGCTTCCAAGTAATTGG + Intergenic
1107760175 13:43669708-43669730 GCATAGAGCTTAGAAATGATAGG + Intronic
1108486549 13:50932714-50932736 TCAAACAGCTTAGAAGAATCTGG + Intronic
1112205749 13:97321840-97321862 GCATACAGCTAGTAAGTAAGTGG - Intronic
1116491963 14:45515295-45515317 GGCAACAGCATAGAAGTAACTGG + Intergenic
1116602476 14:46944295-46944317 CAATACAGCTTAGAAGAAAGTGG - Intronic
1116867248 14:50040715-50040737 GGATACAGCTTAGAAGTGCAAGG + Intergenic
1118111721 14:62728843-62728865 GGATAAAGCCTAGAAGGAACGGG + Intronic
1122250915 14:100439082-100439104 GCATAGAGCTAGGAAGTACCTGG - Intronic
1122499536 14:102187588-102187610 GCCTACAGCTTAGCACTCACAGG - Intronic
1122641594 14:103163262-103163284 GGATACAGAATAGAAGTACCGGG + Intergenic
1123883478 15:24698243-24698265 ACATACAAATTAGAAGTAAAAGG - Intergenic
1124168258 15:27348838-27348860 GCATACTGCTTAGGAGTTCCTGG - Intronic
1124204090 15:27702397-27702419 GAATTCAACTGAGAAGTAACAGG - Intergenic
1125835785 15:42749509-42749531 GCACACAGCTTACAAGAACCAGG + Intronic
1129107785 15:73321181-73321203 TCATACAGCTAAGAAGTGGCAGG + Exonic
1129463244 15:75710374-75710396 CCATACAGCTCAGAAGGAGCTGG + Intronic
1130671368 15:85915822-85915844 GCATCAAGCTAAGAGGTAACGGG + Intergenic
1134247591 16:12551531-12551553 GCATGCACCTTAGAATTACCTGG - Intronic
1138384977 16:56630123-56630145 TCACACAGCTCAGAAGTAAAGGG + Intergenic
1141305415 16:82858457-82858479 GCTTACAGTTTAGAATTGACTGG - Exonic
1142673872 17:1501406-1501428 GCATACAGCTCTCAATTAACAGG - Intronic
1144385023 17:14741383-14741405 GCACAGAGCTTGGAAATAACAGG + Intergenic
1147406820 17:40218474-40218496 GCACACAGCTTGTAAGTAATGGG + Intergenic
1149009645 17:51842044-51842066 CCATACTGCTTATAAGTGACTGG - Intronic
1151467161 17:74293508-74293530 GCAAACAGGTTAAAAGTAAAAGG - Intronic
1153239361 18:3016408-3016430 GCATACAGACTAGAAGGAGCAGG - Intergenic
1155602833 18:27569100-27569122 GGATTCAGCTGAGAAGTCACAGG + Intergenic
1157572023 18:48719041-48719063 GCAGACAGCGTAGAATTAAGAGG - Intronic
1158237395 18:55332853-55332875 GTATACATCACAGAAGTAACTGG - Intronic
1159051993 18:63428987-63429009 GCATTCTGCTTAGAAGAAATTGG - Intergenic
1159623116 18:70662206-70662228 GCATTTAGATTAGAAGTAACTGG - Intergenic
1162502501 19:11061868-11061890 GCATAGGCCTTAGCAGTAACGGG + Exonic
926808228 2:16732853-16732875 GCATACAGCCTCAAAGTACCTGG + Intergenic
929346400 2:40889954-40889976 GAATTCAGCTGAGAATTAACAGG + Intergenic
930952542 2:57160840-57160862 GCATACAGTTGAGAGGTAGCAGG - Intergenic
932901534 2:75706332-75706354 TCAGACAGCTTATAAGTAGCAGG - Intronic
934612387 2:95750883-95750905 GCAGACACTTTAGAAGAAACTGG + Intergenic
934841766 2:97628564-97628586 GCAGACACTTTAGAAGAAACTGG - Intergenic
940065046 2:149618237-149618259 GCTTAAAGCTTTAAAGTAACTGG - Intergenic
942328864 2:174800598-174800620 GCAAATAGCTGAGAAGGAACTGG + Intronic
947158240 2:227185422-227185444 TCATACAGCTAAAAGGTAACTGG - Intronic
1170676129 20:18482550-18482572 GCATACAGCTTAGAAGTAACCGG + Intronic
1172709647 20:36911203-36911225 GCTGACAGGTAAGAAGTAACAGG - Exonic
1172962863 20:38810822-38810844 GCATGCAGCTTGTAAGTGACAGG + Intronic
1173466979 20:43290977-43290999 ACTTACAGCTTAGAAGTAAGTGG - Intergenic
1173550021 20:43926390-43926412 TCATACAGCTTATAAGTGTCAGG - Intronic
1183363540 22:37395466-37395488 GCACACAGCTAAGAAGTGGCAGG + Intronic
949402035 3:3675232-3675254 GCTGACAGCTTAGAACTAAATGG - Intergenic
954908816 3:54086199-54086221 CCTTACAGCCTAGAAGTTACGGG + Intergenic
955927300 3:64020533-64020555 ACATACAGCTTAAAAGTAAATGG + Intronic
956700275 3:71952667-71952689 GCATAGATCTTAAAAGTAATTGG + Intergenic
959122019 3:102243824-102243846 GCATACAGCTAATTAGTGACAGG + Intronic
963014707 3:140811227-140811249 ACATACAGATTAAAAGTAAATGG + Intergenic
966605204 3:181814591-181814613 ACATCCAGCTAGGAAGTAACTGG + Intergenic
970874992 4:20858901-20858923 TCATACAGCTTACAAGTGACAGG + Intronic
971440152 4:26676945-26676967 GCATATAGATTTGAGGTAACTGG - Intronic
973805158 4:54518635-54518657 GCACACAGAGTAGAAGTACCAGG - Intergenic
974420523 4:61666950-61666972 GATTACAGCTTAGAAATCACTGG + Intronic
976020507 4:80618235-80618257 GCATACTTCTTAGAATTAAGAGG + Intronic
978642291 4:110884913-110884935 GCATCCAGCATAGAAGAAAGAGG + Intergenic
981436296 4:144726934-144726956 GCAAGCAGCTCAGAAGTAGCTGG - Intronic
988400642 5:30755603-30755625 CAATACAACTTAGAAGTAACAGG + Intergenic
990151469 5:52822709-52822731 GCAGAAAGATTAGAAGTAATAGG - Intronic
990336327 5:54776265-54776287 GCATACAATTTCCAAGTAACAGG - Intergenic
990604259 5:57393037-57393059 GCATATAGATTAAAAGTAAAGGG - Intergenic
992507445 5:77401141-77401163 GTATAATGCTTAGCAGTAACTGG + Intronic
994753035 5:103762917-103762939 GCACACATCTTAGAAATAAAAGG - Intergenic
995135159 5:108672735-108672757 CAATACAGCTTAGTAATAACCGG - Intergenic
996565670 5:124877747-124877769 TCATACAGCTTAGAGGTCAGGGG - Intergenic
1000606450 5:163332520-163332542 TGATACAGCATAGAAGTCACTGG - Intergenic
1001161120 5:169314996-169315018 ACATATAGGTTAGAAGTAAAAGG + Intergenic
1004686127 6:17946263-17946285 GCATCCATCTTAAAAGTAAAGGG + Intronic
1005783922 6:29222513-29222535 GAATTCAGATTGGAAGTAACAGG + Intergenic
1007308237 6:40923750-40923772 TTACACAGCTTAGAAGTAGCAGG + Intergenic
1007921152 6:45610564-45610586 CCACACAGCTAAGAAGTAGCAGG - Intronic
1008280991 6:49595742-49595764 GCATACAGCTAAGCAGAGACTGG - Intergenic
1013940189 6:115651909-115651931 GCATACAGCATACAAGAAAATGG - Intergenic
1019728820 7:2618723-2618745 GCAAACAGCTTAGATGGAAGTGG - Intergenic
1020466395 7:8484556-8484578 GCATACAGTTTAAAACTTACAGG - Intronic
1023305911 7:38826707-38826729 TCACACAGCTAAGAAGTGACAGG + Intronic
1024759540 7:52578583-52578605 ACATACAGCTCAGAAGAAAAAGG - Intergenic
1033500600 7:141945283-141945305 GAATTCAGCATAGAAGTAGCAGG + Intronic
1037724706 8:21473560-21473582 GCATTCAGCTAAGAAGGAAGAGG + Intergenic
1039690736 8:39862102-39862124 GCATACTGTTTACACGTAACTGG - Intergenic
1040705157 8:50116805-50116827 GCATAGAGCTCAGAAGTTATTGG - Intronic
1040985327 8:53287761-53287783 AGATACAGCTTAGAGGGAACTGG - Intergenic
1043448973 8:80347882-80347904 GCATACAGCTTAGCAATTATCGG - Intergenic
1044333073 8:90944088-90944110 ACATCCAGCTTAGAAGGAACTGG + Intronic
1046510003 8:115190416-115190438 GGATACAGCTTATAAGTGATGGG - Intergenic
1047826111 8:128577800-128577822 GCACATAGTTTGGAAGTAACAGG + Intergenic
1047834257 8:128671036-128671058 GCATCCAGCCTGGAAGAAACTGG + Intergenic
1049934068 9:483851-483873 ACATACAGATGTGAAGTAACTGG + Intronic
1050498392 9:6268197-6268219 GCCTACAGATTAGAAGTGGCAGG + Intergenic
1050745649 9:8873079-8873101 GCAGACAGATTAGAAGTCTCAGG - Intronic
1051152192 9:14094355-14094377 GCATTCAGCTGAAAAGCAACTGG - Intronic
1053530103 9:38872372-38872394 GTATACAGGTTAAAAGTAAAAGG + Intergenic
1054202329 9:62096799-62096821 GTATACAGGTTAAAAGTAAAAGG + Intergenic
1054636029 9:67491561-67491583 GTATACAGGTTAAAAGTAAAAGG - Intergenic
1055611411 9:78029893-78029915 GCAAACAGCTTTGCAGTAACGGG - Intronic
1055854454 9:80669497-80669519 GCATACAGAATAAAAGTAAAGGG - Intergenic
1186646074 X:11508539-11508561 GTATGCAGCTTAGAAGGAAATGG - Intronic
1195822398 X:108960160-108960182 GTATACAGTTTAGAAGTTAATGG + Intergenic
1199879474 X:151961850-151961872 ACAAACAGCTTAGAAGTATCTGG + Intronic
1200385344 X:155884582-155884604 GTTTACATCTTAGAAGTATCTGG - Intronic