ID: 1170676859

View in Genome Browser
Species Human (GRCh38)
Location 20:18490206-18490228
Sequence TCAGTTCTAGACTTACAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170676857_1170676859 -8 Left 1170676857 20:18490191-18490213 CCAGGCCTCTAGGGTTCAGTTCT 0: 1
1: 0
2: 3
3: 22
4: 224
Right 1170676859 20:18490206-18490228 TCAGTTCTAGACTTACAGCTTGG 0: 1
1: 0
2: 1
3: 11
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170676859 Original CRISPR TCAGTTCTAGACTTACAGCT TGG Intronic
902132330 1:14273241-14273263 TCATTTCTAGATTTCCAGGTAGG - Intergenic
902737874 1:18413225-18413247 TCAGAACTAGACCTACAGTTTGG - Intergenic
903369941 1:22828963-22828985 TCACTTGTAGACTTACAGGCAGG + Intronic
903619854 1:24690115-24690137 TCAGTGCTGGAATTACAGGTGGG - Intergenic
911925033 1:103818469-103818491 TCAGTTCTAGAATTTCAATTTGG - Intergenic
916066369 1:161139261-161139283 CTAGTTCTGGACTTAGAGCTAGG - Intergenic
917720233 1:177780057-177780079 TCAGTCCTACAATTACATCTTGG + Intergenic
924629015 1:245719792-245719814 TCACCTCTAGCCTTACTGCTCGG + Intergenic
924744168 1:246817280-246817302 TAAGTTCTAGTGTTGCAGCTGGG - Intergenic
1068443721 10:57094034-57094056 TAAGAGCTATACTTACAGCTAGG - Intergenic
1068657768 10:59592500-59592522 TCAGTTCTAGAATTTCTGTTTGG - Intergenic
1071823285 10:89299159-89299181 TCAGTTCCAGAATTTCAGTTTGG - Intronic
1074846996 10:117407149-117407171 TCCCTTCCAGACTCACAGCTTGG + Intergenic
1078253552 11:9638265-9638287 TCAGTTCTAGTCAAACATCTGGG + Intergenic
1079683759 11:23331042-23331064 TCAGTTCTAGAATTTCTGTTTGG + Intergenic
1085859066 11:80211126-80211148 TCAGTTCTAGAGTTTTAGCTGGG + Intergenic
1086523227 11:87696350-87696372 TCAGTTCCAGAAGTTCAGCTGGG + Intergenic
1087062233 11:93991447-93991469 ACAGTTCCAGATTTACTGCTGGG + Intergenic
1089822131 11:121237974-121237996 TCAGTTGTTGACATAAAGCTGGG + Intergenic
1093773682 12:23047671-23047693 TCAGTTCTAGATTCACACCTAGG + Intergenic
1096892344 12:54784913-54784935 TCAGTTCCAGAATTTCTGCTTGG + Intergenic
1097708155 12:62889357-62889379 TGACTTCAAGACTTATAGCTGGG + Intronic
1097835262 12:64266519-64266541 CCACTTCTGGAATTACAGCTTGG - Exonic
1099437624 12:82662480-82662502 TGAGTTCTAAACTTCCAGCTTGG + Intergenic
1101197313 12:102397261-102397283 TTAATTCTAGAGTTTCAGCTTGG + Intronic
1102019425 12:109671403-109671425 TCACTTCTGGACTTAGAGCCTGG - Intergenic
1105775824 13:23659208-23659230 TGAGCTCAAAACTTACAGCTGGG - Exonic
1110444154 13:75558739-75558761 TCAGTTCTAGAAATATACCTTGG + Intronic
1110730522 13:78875000-78875022 TCAGTTCTGTTTTTACAGCTTGG - Intergenic
1111019124 13:82423547-82423569 TCAGTACTAGGCTTAAAGCCTGG - Intergenic
1112451308 13:99513099-99513121 TATGTTCTAAACTGACAGCTTGG - Intronic
1116283913 14:42946930-42946952 TCAGCTCTAGAATTTCAGTTTGG - Intergenic
1117943912 14:60997891-60997913 TCAGTTTTAGACTTATATGTAGG + Intronic
1118003304 14:61543441-61543463 TCAGTTTGAGACTTACACTTGGG + Intronic
1118243072 14:64080739-64080761 TCAGTTTTGGACTTGAAGCTGGG + Intronic
1118662244 14:68027675-68027697 TCAGCTCTAGAATTTCAGTTTGG + Intronic
1119068373 14:71553805-71553827 TCAGTTCTACACTAAAAACTAGG - Intronic
1123994799 15:25711050-25711072 CCAGGTCTACACTTACGGCTGGG - Intronic
1128434926 15:67637388-67637410 TTAGTTCTAGACTAACCACTGGG - Intronic
1131207946 15:90467381-90467403 GCAGTTCTGGACGTACAGCTGGG + Intronic
1132355328 15:101167676-101167698 TCTGTTCTAGCCTCTCAGCTGGG - Intergenic
1134764130 16:16741508-16741530 TCAGTTCTACACTGACACATAGG - Intergenic
1134981927 16:18617701-18617723 TCAGTTCTACACTGACACATAGG + Intergenic
1137854918 16:51784875-51784897 TCAGCTCTAGATGTACAACTTGG + Intergenic
1138903017 16:61297087-61297109 GCAGTTCTAGGCTTAAAGGTGGG + Intergenic
1140572477 16:76124476-76124498 TCAGTTCTTGACTATCATCTGGG - Intergenic
1141360352 16:83390012-83390034 TCTGTCCTAGGCTTGCAGCTGGG + Intronic
1141762405 16:86037523-86037545 TCCGTTCCAAACTTCCAGCTTGG - Intergenic
1155034435 18:22013560-22013582 TCAGTTCTAGAATTTCCACTTGG + Intergenic
1157640855 18:49212906-49212928 TGACCTCTATACTTACAGCTTGG + Intronic
1157680982 18:49606176-49606198 TCAGTTCCAGAATTTCTGCTTGG - Intergenic
1159262269 18:66029654-66029676 TCTGTTCTAGAATTCCATCTAGG - Intergenic
1160006900 18:75074788-75074810 TCAGGACAAGACTCACAGCTGGG + Intergenic
1161161795 19:2765767-2765789 TCAGTTCTAGGATAGCAGCTGGG - Intronic
1161516665 19:4700221-4700243 TGAGTTCCAGACTGACAGCCAGG - Exonic
1163130265 19:15268057-15268079 TCAGTTCTAAACTGAGAGCCTGG + Intronic
1163635910 19:18437215-18437237 TCAGTTCCAGGCTCACAGCCAGG + Intronic
1167700523 19:51041624-51041646 TCAGGTCTAGATTAACTGCTTGG - Intergenic
925162642 2:1696463-1696485 TCAGTTCTAGAATTTCAGTTTGG - Intronic
928601126 2:32904443-32904465 TCGGTCCTAACCTTACAGCTAGG + Intergenic
929802151 2:45113154-45113176 GCAGATCTAGCCTTAAAGCTGGG + Intergenic
932869609 2:75384926-75384948 TTAGTTGTAGAGTTATAGCTGGG - Intergenic
936101985 2:109590181-109590203 TCAGCAGTAGACTTACAGGTTGG + Intronic
936345106 2:111669797-111669819 TCACTTCTAGACGTACGGGTGGG - Intergenic
938608532 2:132921979-132922001 ACATTTCTAGACCTACATCTTGG - Intronic
942535175 2:176955823-176955845 TCAGTTCACTACTTACAGATAGG + Intergenic
943478916 2:188394361-188394383 TCATTTCCAGACTTTCAGGTTGG + Intronic
943616248 2:190095986-190096008 TCAGTTCTTGTCTTAGACCTCGG + Intronic
944303145 2:198147821-198147843 TGAGTGCTAGACTCTCAGCTTGG - Exonic
945655803 2:212621638-212621660 TCAGTTCTAGAATTTCTGATTGG - Intergenic
948472001 2:238188410-238188432 TGAGTTATAGACTTGCAGCTGGG - Intronic
1170676859 20:18490206-18490228 TCAGTTCTAGACTTACAGCTTGG + Intronic
1172322602 20:34008134-34008156 TCCATACTAGACTTACAGCAGGG - Intronic
1173195065 20:40907307-40907329 TCACTGCTAGTCTGACAGCTAGG - Intergenic
1179578917 21:42326131-42326153 TCAGTTCTATACTTTCTACTTGG - Intergenic
1180762073 22:18218303-18218325 TCAGTTCTAGAATTTCTGTTTGG - Intergenic
1180773594 22:18406305-18406327 TCAGTTCTAGAATTTCTGTTTGG + Intergenic
1180804943 22:18655855-18655877 TCAGTTCTAGAATTTCTGTTTGG + Intergenic
1180805800 22:18713556-18713578 TCAGTTCTAGAATTTCTGTTTGG - Intergenic
1180965441 22:19785809-19785831 TCAGCTCCAGACATCCAGCTTGG - Exonic
1181069654 22:20325021-20325043 TCAGTTCTAGAATTTCTGTTTGG + Intergenic
1181192693 22:21153239-21153261 TCAGTTCTAGAATTTCTGTTTGG + Intergenic
1181216749 22:21339337-21339359 TCAGTTCTAGAATTTCTGTTTGG - Intergenic
1203235424 22_KI270731v1_random:147287-147309 TCAGTTCTAGAATTTCTGTTTGG + Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
956980633 3:74633314-74633336 TCATTTCTATACTCACATCTTGG + Intergenic
958662801 3:97093153-97093175 AAAGTTATAGACTTACAGCAAGG - Intronic
958708091 3:97682020-97682042 TCAGTTATAAACTTTCAGCTTGG - Intronic
966011863 3:175088114-175088136 TCAGTTCTAGATTAACTGCATGG - Intronic
967289988 3:187910163-187910185 TCAGTTCTTAACTTAAAGGTGGG + Intergenic
969169669 4:5349799-5349821 TCAGTTCCAGAATTTCTGCTTGG - Intronic
970419252 4:15889927-15889949 TCAGTCCTAGACTTAAAGTGAGG - Intergenic
973553141 4:52055262-52055284 TCAGTTCTACACTTATAACGTGG + Intronic
976690301 4:87861625-87861647 TCAGTCCAAGACTTAAGGCTTGG - Intergenic
978688579 4:111480029-111480051 TCAGTTCTTGGTTTTCAGCTTGG - Intergenic
984938583 4:184911648-184911670 TCAGTTGTTGACATAAAGCTGGG - Intergenic
987876618 5:23688630-23688652 TCAGTTGTTGACATAAAGCTGGG + Intergenic
987956687 5:24750054-24750076 TCAGTTGTTGACATAAAGCTGGG - Intergenic
991626931 5:68612077-68612099 TCAGTTCCAGACTTTCTGTTTGG - Intergenic
993331886 5:86610946-86610968 TCAGTTCTTGATTTACTTCTTGG + Intergenic
994943873 5:106360404-106360426 CCACTTCTATACTTTCAGCTTGG + Intergenic
997022402 5:130016815-130016837 TTAGATCTAGAATTCCAGCTTGG + Intronic
997162788 5:131626413-131626435 CCTGCTCTAGACTTACAGATTGG + Intronic
999885868 5:155922005-155922027 TTAGTTCTTGATATACAGCTAGG + Intronic
1001648697 5:173300417-173300439 TGAGTTCTAGACTAACAGCTGGG + Intergenic
1004893630 6:20125452-20125474 TTAGTTCAAGACATACAGCTGGG - Intronic
1006298554 6:33180948-33180970 TCACTGCTAGACTTACCGCAGGG + Exonic
1008977513 6:57445361-57445383 TCAGTTCTAACCTTGCATCTTGG + Intronic
1011634256 6:89355186-89355208 TAAATTCTTGACTGACAGCTGGG + Intergenic
1012736833 6:102958616-102958638 TCACTTTTTGACTTACAGCAGGG + Intergenic
1014928552 6:127304716-127304738 TCAGCTCTAGAATTTCTGCTTGG - Intronic
1016689831 6:146924419-146924441 TCAGCTCTAGACATACAATTTGG - Intergenic
1021441280 7:20679908-20679930 ACAGTTCTAGTGTTACACCTAGG - Intronic
1022454163 7:30543752-30543774 TCAGTTGTTGACATAAAGCTGGG + Intronic
1022521572 7:31011279-31011301 ACAGTTCTAGAATGATAGCTGGG - Intergenic
1022549519 7:31225807-31225829 TCAGTTCTAGAATTTCTGTTTGG + Intergenic
1026405178 7:70057708-70057730 TCTGTTCTAGCCTTTCAGATTGG + Intronic
1028212053 7:88085699-88085721 TCAGTTCAAGAAATAAAGCTCGG + Intronic
1029256665 7:99274076-99274098 TGAGTTCTTGGCTTAGAGCTGGG + Intergenic
1030265747 7:107620222-107620244 TAAATTCTAGACTTACAGCCTGG - Exonic
1030758829 7:113324963-113324985 TCTGTTCTGGATTCACAGCTGGG - Intergenic
1031614344 7:123863782-123863804 TGAGTACTACACTCACAGCTAGG - Intronic
1032897073 7:136263310-136263332 TCAGTTGTTGACATAAAGCTGGG - Intergenic
1033915108 7:146314730-146314752 TCAGATCTATATTTACTGCTGGG + Intronic
1034159768 7:148984323-148984345 TCATTTCTAGGTTAACAGCTTGG - Intergenic
1039229191 8:35424492-35424514 TCATTCCTAGACTGACAGCCTGG - Intronic
1039597021 8:38799235-38799257 TCAGCTCTAGGCTAACGGCTGGG - Intronic
1043909211 8:85841169-85841191 TTAGTTCCAGGCATACAGCTGGG - Intergenic
1048067156 8:130981999-130982021 CCAGATATAGACTTAGAGCTAGG + Intronic
1051932837 9:22407203-22407225 TCAGCTCTAGAATTTCAGTTTGG - Intergenic
1053288466 9:36864766-36864788 GCACCTCTAGACTGACAGCTTGG - Intronic
1057771547 9:97972584-97972606 TCAGAAATAGACTTACAGCTGGG + Intergenic
1058119812 9:101126196-101126218 TCAGTTGTTGACATAAAGCTGGG - Intronic
1059688546 9:116661446-116661468 TCAGTGCCAGGTTTACAGCTAGG + Intronic
1187066811 X:15848650-15848672 TCAGATTTAGACTTACAAATAGG - Intronic
1187325193 X:18279668-18279690 TCAGTTCTAGAAGTTCAGTTTGG - Intronic
1188512806 X:30954934-30954956 TCACATCTAGACTTACAACTTGG - Intronic
1188629992 X:32343844-32343866 ACACTTCTACACATACAGCTTGG - Intronic
1188941474 X:36242484-36242506 TCAGTTCCAGACGTTCAGTTTGG - Intronic
1192531909 X:71895362-71895384 TCAGTTCTAGCCTTCTTGCTGGG - Intergenic
1193358941 X:80557222-80557244 TGAGCTCTAGAATTTCAGCTTGG - Intergenic
1194197463 X:90912978-90913000 TCAGTTCTAGAAGATCAGCTTGG - Intergenic
1200544262 Y:4499819-4499841 TCAGTTCTAGAAGATCAGCTTGG + Intergenic