ID: 1170677801

View in Genome Browser
Species Human (GRCh38)
Location 20:18498521-18498543
Sequence ATGCCTTTCTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170677801_1170677803 2 Left 1170677801 20:18498521-18498543 CCTTCACTCTTCTAGAAAGGCAT No data
Right 1170677803 20:18498546-18498568 TTTGTTAGGTCCTTTTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170677801 Original CRISPR ATGCCTTTCTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr