ID: 1170678933

View in Genome Browser
Species Human (GRCh38)
Location 20:18507933-18507955
Sequence CACCCACAGCTGCAACAAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 162}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170678933_1170678941 21 Left 1170678933 20:18507933-18507955 CCTGCTTGTTGCAGCTGTGGGTG 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1170678941 20:18507977-18507999 GCGGCTCCGGCCAGGTGAGCGGG 0: 1
1: 0
2: 0
3: 23
4: 206
1170678933_1170678937 2 Left 1170678933 20:18507933-18507955 CCTGCTTGTTGCAGCTGTGGGTG 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1170678937 20:18507958-18507980 GACGGCTCTAGCTAGGTGAGCGG 0: 1
1: 0
2: 0
3: 7
4: 63
1170678933_1170678936 -5 Left 1170678933 20:18507933-18507955 CCTGCTTGTTGCAGCTGTGGGTG 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1170678936 20:18507951-18507973 GGGTGAGGACGGCTCTAGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 107
1170678933_1170678940 20 Left 1170678933 20:18507933-18507955 CCTGCTTGTTGCAGCTGTGGGTG 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1170678940 20:18507976-18507998 AGCGGCTCCGGCCAGGTGAGCGG 0: 1
1: 0
2: 0
3: 14
4: 143
1170678933_1170678938 8 Left 1170678933 20:18507933-18507955 CCTGCTTGTTGCAGCTGTGGGTG 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1170678938 20:18507964-18507986 TCTAGCTAGGTGAGCGGCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 142
1170678933_1170678939 13 Left 1170678933 20:18507933-18507955 CCTGCTTGTTGCAGCTGTGGGTG 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1170678939 20:18507969-18507991 CTAGGTGAGCGGCTCCGGCCAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1170678933_1170678942 22 Left 1170678933 20:18507933-18507955 CCTGCTTGTTGCAGCTGTGGGTG 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1170678942 20:18507978-18508000 CGGCTCCGGCCAGGTGAGCGGGG 0: 1
1: 0
2: 0
3: 10
4: 136
1170678933_1170678944 30 Left 1170678933 20:18507933-18507955 CCTGCTTGTTGCAGCTGTGGGTG 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1170678944 20:18507986-18508008 GCCAGGTGAGCGGGGCGCATAGG 0: 1
1: 0
2: 1
3: 20
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170678933 Original CRISPR CACCCACAGCTGCAACAAGC AGG (reversed) Exonic
900497142 1:2980909-2980931 CACCCCCAGCTGCCGCCAGCCGG - Intergenic
901478279 1:9505799-9505821 CTCCCAAAGCTGGAAGAAGCAGG - Intergenic
904110022 1:28118527-28118549 CCCCCATAGCTGCAACCACCAGG - Intergenic
904318437 1:29681165-29681187 CACGCACAGCTGCAGGAAGGAGG + Intergenic
904439049 1:30517817-30517839 CACGCACAGCTGCAGGAAGGAGG - Intergenic
906199508 1:43950012-43950034 CACCTCCAGCTGCACCCAGCTGG - Exonic
907578553 1:55551027-55551049 CACCCTCAGCAGCACAAAGCAGG + Intergenic
910458916 1:87427143-87427165 CATCAACAGCTGCAGCAAGCAGG - Intergenic
912412624 1:109489017-109489039 CAGCCACCGCTGCTACAACCTGG - Exonic
914316198 1:146514042-146514064 CATCAACAGCTGCAGCAAGCAGG - Intergenic
914498157 1:148219319-148219341 CATCAACAGCTGCAGCAAGCAGG + Intergenic
916091822 1:161313702-161313724 CACCCACAGCTAGAAGAACCCGG - Intergenic
919314066 1:195948643-195948665 CAGCCACAGCTGCACCCAGGAGG + Intergenic
920198479 1:204244962-204244984 CACCTACAGCTCCAACAGCCCGG - Exonic
922422161 1:225467462-225467484 CACCCACAGCTGCAGAGAGCCGG + Intergenic
922508885 1:226146057-226146079 CACCCAAAGCAGAAACAATCTGG + Exonic
924456067 1:244219740-244219762 CACCCATTGCTGCCACGAGCCGG - Intergenic
1065844445 10:29734027-29734049 CACACACAGCTTAAACAAGGTGG + Intronic
1066364773 10:34766273-34766295 CACCCAAAGCTGACACTAGCAGG + Intronic
1066447866 10:35500085-35500107 CACAGACAGCAGCAACAAACTGG - Intronic
1067189402 10:44057020-44057042 CCCTCACAGCTGCACCCAGCGGG - Intergenic
1068147353 10:53088589-53088611 CACCTCAGGCTGCAACAAGCAGG + Intergenic
1070281122 10:75049658-75049680 CACCCACACCTCGAAGAAGCAGG + Intronic
1071945233 10:90636252-90636274 CACCCCCAGCTGAATCAAGATGG - Intergenic
1072293779 10:93990883-93990905 TACCTACAGCTTTAACAAGCTGG + Intergenic
1073102243 10:101012397-101012419 CACCCCCAGCTGCCACAGGGTGG + Intronic
1075119717 10:119655640-119655662 CAGCCACAACTGCAACTTGCTGG - Intronic
1077097628 11:805609-805631 CACCCACCCCTGCTACAAGCCGG + Intronic
1077564853 11:3291077-3291099 CACCCACAGATGCATTCAGCAGG - Intergenic
1077570743 11:3336894-3336916 CACCCACAGATGCATTCAGCAGG - Intergenic
1082169865 11:48990825-48990847 CACCAACAGATGCAAGAAACTGG - Intergenic
1084086669 11:66858119-66858141 CATCCTCAGCGGCAACCAGCTGG + Exonic
1084470209 11:69355067-69355089 CACCCACAGCTTCATCGAGGTGG - Intronic
1085507703 11:77069609-77069631 CTCCCCCAGCTGCAAAGAGCAGG + Intronic
1086945529 11:92840581-92840603 CACCACCAGCTGCAAGATGCTGG - Exonic
1087559744 11:99772838-99772860 CACCCACAGAGGCAGAAAGCTGG + Intronic
1089467149 11:118692704-118692726 CACGGACAGCTGCAGCAGGCTGG - Intergenic
1092097813 12:5858555-5858577 CTCCCACAGCTGCAAAATTCTGG - Intronic
1093141868 12:15518277-15518299 CACCCACAGCTGCAGCAGCTGGG + Intronic
1096616313 12:52835190-52835212 CAGGCACAGCTCCAAAAAGCAGG + Intergenic
1097661872 12:62438862-62438884 CACTCACAGCTGCTACAATAGGG + Intergenic
1099067724 12:78004917-78004939 CACCCAAAACTGAAACAAGAGGG - Intronic
1102853677 12:116276294-116276316 CACACACAAAAGCAACAAGCTGG - Intronic
1103032309 12:117626720-117626742 AACTCAGATCTGCAACAAGCAGG - Intronic
1104410516 12:128553933-128553955 CCCCCGGAGCTGCAACAAGGAGG - Intronic
1104662834 12:130623900-130623922 CACCCACAGTGGCAACTGGCTGG + Intronic
1104674491 12:130703501-130703523 CACCCACTGCTGCGACCACCCGG + Intronic
1104731031 12:131105454-131105476 GCCCCACAGCTGGAATAAGCTGG + Intronic
1104916444 12:132267257-132267279 CATCCACCCCTGCCACAAGCTGG - Intronic
1110542065 13:76717968-76717990 CAACAACAGCAGCAAGAAGCTGG + Intergenic
1112006082 13:95254887-95254909 CACCCACACCTACAACATGCTGG + Intronic
1113076049 13:106469033-106469055 CCCACACACCTGCAAGAAGCTGG - Intergenic
1113661389 13:112108352-112108374 CAGCCACATCTCCAAAAAGCCGG - Intergenic
1113969463 13:114177363-114177385 CACCCACAGCTGCCACCCTCAGG - Intergenic
1115322331 14:32096077-32096099 CACACACAGCTCCATCAAGTGGG - Intronic
1117622687 14:57603664-57603686 GAGCCACAGCTGTAACAATCTGG - Intronic
1117746689 14:58876793-58876815 CTCCCATAGCTGCAAGAAACTGG - Intergenic
1118746927 14:68780987-68781009 CTCCCCCAGCTGCCTCAAGCTGG - Intergenic
1118748736 14:68791875-68791897 CACCAACAGGAGCAGCAAGCTGG + Intronic
1123459846 15:20459712-20459734 CACCCACTCCTGCAAGCAGCAGG + Intergenic
1123658216 15:22540708-22540730 CACCCACTCCTGCAAGCAGCAGG - Intergenic
1123893289 15:24802757-24802779 AGCCCACAGCTGCAACTCGCTGG - Intergenic
1124312081 15:28635200-28635222 CACCCACTCCTGCAAGCAGCAGG - Intergenic
1125085914 15:35729003-35729025 CACGCACATCTGCAATAAGAAGG - Intergenic
1125146060 15:36469982-36470004 CAGGCAGAGCTGCTACAAGCAGG + Intergenic
1125430488 15:39588665-39588687 AAACCAGATCTGCAACAAGCAGG + Exonic
1126533499 15:49735086-49735108 CACCCCCAGCTGTCACAAGCAGG + Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1127033722 15:54891435-54891457 CAGCCACAGCCCCAACTAGCTGG - Intergenic
1127659641 15:61088394-61088416 AAGCCACAGCTGCAAGAAACGGG + Intronic
1127932906 15:63609216-63609238 CAGCCTCAGCTGGAAGAAGCAGG + Exonic
1130818023 15:87461272-87461294 CCACCACAACTGAAACAAGCTGG + Intergenic
1132860096 16:2066318-2066340 CACCAACAGCTGCCACAGCCTGG - Intronic
1135879423 16:26239959-26239981 CACCCACAGCAGCAACAGCGTGG + Intergenic
1136621991 16:31435776-31435798 CACCCAGGGCTGCAGCACGCTGG + Exonic
1139278592 16:65750515-65750537 AACCCACAGCAGAGACAAGCTGG + Intergenic
1141128134 16:81415804-81415826 GACCCACAGAGGCAACAGGCAGG - Intergenic
1141367586 16:83457595-83457617 CATCCACAGTAGCAATAAGCAGG + Intronic
1141544816 16:84758836-84758858 GAGGGACAGCTGCAACAAGCTGG - Intronic
1142817255 17:2436115-2436137 CACTAACAGCTGCAGCAAACTGG - Intronic
1147791065 17:43014581-43014603 CACTCTCAGAGGCAACAAGCAGG + Intergenic
1151680670 17:75621117-75621139 CTCCCACAGCTACACCATGCAGG + Intergenic
1151968760 17:77446235-77446257 CACCCAAAGCTGGAAGAGGCAGG - Intronic
1152296401 17:79469636-79469658 CACCCACAGCTGCACACAACTGG + Intronic
1152637779 17:81437184-81437206 AACCCACAGCTTCAACCTGCCGG - Intronic
1158104904 18:53874349-53874371 CACCCCCAGCTGCTTCAAGCAGG - Intergenic
1160034473 18:75287576-75287598 CACCAACGGCTGTAACAACCTGG + Exonic
1162027072 19:7900496-7900518 CTACCTCAGCTACAACAAGCTGG + Exonic
1164608854 19:29618677-29618699 CACCCACAGCTGCCTAGAGCCGG - Intergenic
1166369998 19:42295166-42295188 CCTCCACAGCTGCCACAGGCAGG + Exonic
1166673206 19:44723875-44723897 CTCCCCCAGCTGCCACATGCAGG + Intergenic
1167321608 19:48800085-48800107 CACCCAGAGTTTCGACAAGCTGG - Exonic
1168587334 19:57604081-57604103 CTCCCACAGCAACAACAGGCAGG - Intronic
1168596884 19:57684550-57684572 CTCCCACAGCAACAACAGGCAGG - Intronic
928419811 2:31129654-31129676 CTCTCGCAGCTGCAACATGCAGG - Intronic
930612146 2:53555019-53555041 CACCCACTGCTGCCACAGGGTGG - Intronic
931966608 2:67542862-67542884 CACCCACTGCTGCAAACATCTGG - Intergenic
932335466 2:70928581-70928603 CACCCAGAGCTGCAGGAAGATGG + Intronic
934705802 2:96479230-96479252 CACCCACAGCAGCCAAAAGATGG - Intergenic
935934366 2:108165921-108165943 CACCCACAGCTGGTGCATGCTGG + Intergenic
937234425 2:120421937-120421959 CACCCACAGGTTCAAGACGCTGG + Intergenic
937990656 2:127660298-127660320 AACCCACAGCAGCAACCAGTTGG + Intronic
938170062 2:129068122-129068144 CTCCCACACCTGCAAGAAGTGGG - Intergenic
938213773 2:129490919-129490941 CTCCCACAGCTGCAACAGTGAGG + Intergenic
938705443 2:133920591-133920613 CACCCCAAGCTGCAGTAAGCAGG + Intergenic
941544589 2:166832795-166832817 CCCCAACATCTGCAAGAAGCTGG + Intergenic
943462915 2:188191906-188191928 AACCCCCAGCAGCAACAAGGAGG - Intergenic
947096360 2:226571542-226571564 CATGCCCAACTGCAACAAGCTGG - Intergenic
948606785 2:239140970-239140992 CACCCACAGCTCCCCCAACCTGG + Intronic
948800271 2:240430278-240430300 CTCCCTCAGCTGCACCATGCAGG + Intergenic
1168790396 20:572263-572285 CACCCGCAGCTGCAGCGAGTGGG + Intergenic
1170678933 20:18507933-18507955 CACCCACAGCTGCAACAAGCAGG - Exonic
1170787952 20:19483730-19483752 GCCCCACAGTTGCAAGAAGCTGG - Intronic
1179482095 21:41685020-41685042 CCCCCGCAGCTGCCGCAAGCTGG - Intergenic
1179658155 21:42858390-42858412 AACCCACAGGAGCAACCAGCTGG + Intronic
1179795422 21:43779857-43779879 CACCCACACCTGCAGCACGAAGG - Intergenic
1180098812 21:45574797-45574819 CCCACACAGCTGCAGCCAGCTGG - Intergenic
1181839555 22:25644928-25644950 CATCCAGAGCTGCACCAAGGAGG + Intronic
1182700982 22:32238141-32238163 CACCAGCACCTGCAACAAGCAGG + Intronic
1183585816 22:38752395-38752417 CACCCAAGGTTGCAACAAGAAGG + Intronic
1184700043 22:46164653-46164675 CACCCTCAGCTGCTAGAAGGTGG + Intronic
1185269044 22:49919825-49919847 CACTCACAGCTGCAGCCACCAGG - Exonic
950522173 3:13503923-13503945 CACCAAGAGCTGCAAAAAGGGGG - Intronic
952931692 3:38365670-38365692 CACCCACAGCAGCCTCCAGCTGG - Exonic
954299412 3:49691488-49691510 CACCCCCAGCAGCCACCAGCAGG + Exonic
960867212 3:122213844-122213866 CAACCACAGCTGCAATAGTCAGG - Intronic
961161459 3:124730338-124730360 AACCCACGGGTGCAGCAAGCCGG + Intergenic
967887382 3:194342303-194342325 CACCCTCAACTTCAACATGCTGG - Exonic
968538513 4:1150285-1150307 CACCCGCAGCTGCTGCAAGGTGG + Intergenic
970674333 4:18431613-18431635 CACACACTGCTGCAAGAAGAAGG + Intergenic
971331315 4:25683794-25683816 CAACCTCAGCACCAACAAGCAGG - Intergenic
975185021 4:71391823-71391845 CACTCAAAGCTACAACCAGCAGG - Intronic
975245153 4:72111884-72111906 GACCCAAAGCTGAAACTAGCAGG - Intronic
984002200 4:174263040-174263062 AACCAGCAGCTGCAACAAGAAGG - Exonic
986285082 5:6353399-6353421 CACCCAGAGCTGGAAGAGGCAGG + Intergenic
986950678 5:13080775-13080797 CACCCACAGCTCCAGTAAGCAGG - Intergenic
987945813 5:24607078-24607100 CACCCTCAGCTTCAGCAAACAGG + Intronic
991517383 5:67452844-67452866 CACCCACAGCTGTAAATAGTGGG - Intergenic
998261164 5:140632948-140632970 CAGCAGCAGCAGCAACAAGCAGG + Exonic
999287051 5:150400367-150400389 CACCCATAGCCTCAACATGCAGG - Intergenic
999731654 5:154479976-154479998 CTCCCACAGGTGGAACCAGCAGG - Intergenic
1000003530 5:157162743-157162765 CACCCACAGCTCCACCAAAAAGG - Exonic
1002106034 5:176879811-176879833 CAGCCACTGCTGCAGCCAGCTGG - Exonic
1003816045 6:9841138-9841160 CACCTACAGCTGAGAGAAGCAGG + Intronic
1004340066 6:14800193-14800215 CAGCTACAGCTGCAGCCAGCAGG - Intergenic
1007814175 6:44508587-44508609 CATTCACAGCAGCAGCAAGCAGG - Intergenic
1010381540 6:75231354-75231376 AACCCACAGCTACGAAAAGCAGG + Intergenic
1014149151 6:118033722-118033744 CAGCCACAGCAGCAAGAAGAGGG + Intronic
1014978402 6:127917694-127917716 GACCAACACCTGAAACAAGCAGG + Intronic
1018171450 6:161146476-161146498 CACCCACAGCTGCAACGTGAAGG + Intronic
1018743488 6:166747532-166747554 CACACATAGCTGCACAAAGCTGG - Intronic
1024526529 7:50354284-50354306 CACCCACAGCAGTAACCAACTGG - Intronic
1029252395 7:99246277-99246299 CAAACCCAGCTGCCACAAGCAGG + Intergenic
1032623426 7:133561895-133561917 CACCCAGAGCTGGATTAAGCAGG + Intronic
1033224961 7:139554215-139554237 CAGCCACAGCTGGAGCAGGCGGG - Intergenic
1033771812 7:144560640-144560662 CACCCATCGCTGCCACCAGCTGG + Intronic
1036615709 8:10385754-10385776 CTCCCACAGCTGCAGAAACCAGG - Intronic
1036658249 8:10691432-10691454 CACCCACAGCTGCAGGATGCAGG + Intronic
1038706330 8:29897354-29897376 CAACCACGGCTGCACAAAGCTGG + Intergenic
1043376153 8:79652032-79652054 CAGCCACAGCTGCTAAAGGCAGG - Intronic
1045145625 8:99340783-99340805 CACCACCAACTGCAACAGGCTGG - Intronic
1047990037 8:130276580-130276602 CAGCCACAGCTGAGACAATCTGG + Intronic
1054731108 9:68704028-68704050 CAGCCACATCTGCAAGAAGCAGG + Intergenic
1059340397 9:113594625-113594647 CCCCCAGAGCTGGATCAAGCCGG - Intronic
1060060595 9:120455942-120455964 AACCCACAGCTGCAAGAAAAGGG + Intronic
1061599458 9:131657634-131657656 CAGCCACAGCAGCCACAATCAGG - Intronic
1061958365 9:133975301-133975323 CACCCACAGCAGGAACTTGCTGG + Intronic
1186000457 X:5003226-5003248 GACACACACCTGCAACAATCAGG + Intergenic
1190364481 X:49678663-49678685 CACCCTGAACTGCAATAAGCAGG - Intergenic
1192133450 X:68574616-68574638 CACCAAAAGCCTCAACAAGCAGG - Intergenic
1193865485 X:86725826-86725848 CACCCACATGTGCTACCAGCAGG - Intronic
1194401301 X:93440340-93440362 CACCCACATGTGCCACAAGCAGG + Intergenic
1195613842 X:106897212-106897234 CTCTCACTGCTGCAACAAGGTGG + Intronic
1196153006 X:112394274-112394296 CACCCTCAGCTGAAACATTCAGG - Intergenic
1197414968 X:126164607-126164629 CACCCACTGCTACAACTGGCCGG - Exonic
1197643448 X:128992588-128992610 CACCCACATCTGCCACCTGCAGG - Intergenic
1199578838 X:149341383-149341405 CAGACACAGCTGATACAAGCAGG - Intergenic