ID: 1170679221

View in Genome Browser
Species Human (GRCh38)
Location 20:18510054-18510076
Sequence CAAAGTTAACAAAGTGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170679218_1170679221 -9 Left 1170679218 20:18510040-18510062 CCAGCTCTTTTCTCCAAAGTTAA 0: 1
1: 0
2: 0
3: 26
4: 301
Right 1170679221 20:18510054-18510076 CAAAGTTAACAAAGTGCGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 160
1170679216_1170679221 21 Left 1170679216 20:18510010-18510032 CCATTATGAACCAAACTTGAAGA 0: 1
1: 0
2: 0
3: 7
4: 154
Right 1170679221 20:18510054-18510076 CAAAGTTAACAAAGTGCGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 160
1170679215_1170679221 22 Left 1170679215 20:18510009-18510031 CCCATTATGAACCAAACTTGAAG 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1170679221 20:18510054-18510076 CAAAGTTAACAAAGTGCGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 160
1170679217_1170679221 11 Left 1170679217 20:18510020-18510042 CCAAACTTGAAGATCAGTATCCA 0: 1
1: 0
2: 0
3: 12
4: 138
Right 1170679221 20:18510054-18510076 CAAAGTTAACAAAGTGCGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170679221 Original CRISPR CAAAGTTAACAAAGTGCGGA AGG Intronic
906082992 1:43106721-43106743 CAAAGTTTCCACAGTGTGGAAGG + Intergenic
906844269 1:49173890-49173912 CAAAGTAAACAAAGTGTTTAAGG + Intronic
907167255 1:52424546-52424568 CTAAGTTAACAAAGAGCTGAAGG + Intronic
909318413 1:74252863-74252885 CAAAGCTTCCAAAGTGTGGAGGG + Intronic
909759385 1:79269967-79269989 CAAAGCTTCCACAGTGCGGAAGG - Intergenic
910654583 1:89606784-89606806 CAAACTTAACACAGTTGGGAGGG - Intergenic
910953493 1:92676341-92676363 CAAAGTTTAAAAAGGGAGGAGGG + Intronic
912867230 1:113268458-113268480 CAGAGTTAGCTAAGTGAGGATGG - Intergenic
913410068 1:118541858-118541880 CCAAGTCAACAAAGAGTGGAAGG + Intergenic
918157259 1:181860565-181860587 AATAATTAACAAAGTGGGGAAGG + Intergenic
918791893 1:188840617-188840639 CAAAGCTTACACAGTGTGGAAGG + Intergenic
924569229 1:245222953-245222975 CAAACATAACAAAGTGTGAAAGG - Intronic
1063829252 10:9933334-9933356 CTAGGTTTACAAAGTGGGGAAGG - Intergenic
1064449064 10:15425575-15425597 CAAAGCTACCACAGTGTGGAAGG + Intergenic
1067363328 10:45601540-45601562 CAAAGTTTCCACAGTGTGGAAGG - Intergenic
1067516071 10:46945759-46945781 CAAAGGAAACAAAGTGGGTATGG + Intronic
1067646177 10:48106051-48106073 CAAAGGAAACAAAGTGGGTATGG - Intergenic
1069092086 10:64212185-64212207 GAAATTTACCAAAGTGCTGATGG - Intergenic
1070050521 10:72884914-72884936 CAAAGATAACAGAGTGAGGGAGG - Intronic
1079413101 11:20208317-20208339 AACAGTTAAGAAAGTGCGAAGGG + Intergenic
1079730433 11:23934202-23934224 CAAAGCTTCCAAAGTGTGGAAGG + Intergenic
1080296193 11:30731240-30731262 CATAGCTCACAAAGTGCTGAGGG + Intergenic
1086443506 11:86850976-86850998 CAAAGTTTCCACAGTGTGGAAGG - Intronic
1093516938 12:19998963-19998985 TAAAGTTAACCTAGTGAGGAAGG + Intergenic
1097629394 12:62041389-62041411 AAAAGTTATTAAAGTGAGGAAGG + Intronic
1098655059 12:73017231-73017253 CAAAATTGACAAAGTGCTGCAGG - Intergenic
1108851479 13:54736861-54736883 CAAAGTTTCCACAGTGTGGAAGG + Intergenic
1108858793 13:54828771-54828793 CAAAGTTTGCACAGTGTGGAAGG + Intergenic
1109835844 13:67855991-67856013 CAAAGTGATCAAAGTGCTGTGGG - Intergenic
1110114613 13:71797085-71797107 CTGAGTTAACAAAGTGAGAAAGG - Intronic
1110417626 13:75269374-75269396 CAAAGTTTCCACAGTGTGGAAGG - Intergenic
1110497987 13:76190974-76190996 CAAAGTTTCCACAGTGCAGAAGG - Intergenic
1110862274 13:80356373-80356395 CAAAGCTACCACAGTGTGGAAGG - Intergenic
1112245510 13:97729883-97729905 CAAAGCTAACAATGAGCTGAGGG + Intergenic
1114575297 14:23707337-23707359 CAAAGTTTCCACAGTGTGGAAGG + Intergenic
1116543557 14:46133620-46133642 CAAATTTTACTAAGTGGGGAAGG + Intergenic
1117565770 14:56991866-56991888 CAAAGCTACCACAGTGTGGAAGG - Intergenic
1119300181 14:73565843-73565865 CAAAGTTTCCACAGTGTGGAAGG + Intergenic
1119375985 14:74193433-74193455 CAAATTTAACAAGGTATGGAAGG - Intronic
1120159623 14:81131356-81131378 GAAAGTTACCAAAGTGAGTAAGG - Intronic
1121370092 14:93348940-93348962 CAAAGCTTCCACAGTGCGGAAGG - Intronic
1125200892 15:37100080-37100102 CAAAGCTAAAAAAGGGGGGAGGG - Intronic
1125921990 15:43530419-43530441 CAAAGTTAACAGGGAGAGGATGG + Exonic
1127158956 15:56160076-56160098 CAAGGTTAAAAAAGTGGGGAAGG + Intronic
1131212737 15:90511371-90511393 CAAAGCTTCCACAGTGCGGAAGG - Intergenic
1131941953 15:97576552-97576574 CTCAGTTAACATTGTGCGGATGG - Intergenic
1132195942 15:99914897-99914919 TAAAATTAACAAAATGCAGAGGG - Intergenic
1132750999 16:1457676-1457698 GAAAGGTAACAAAGTGCACATGG - Exonic
1132828623 16:1917079-1917101 CAAAGTTAACAAATAGGGGTAGG + Intronic
1139147882 16:64344819-64344841 CAAAGCTACCACAGTGTGGAAGG - Intergenic
1139817002 16:69683057-69683079 CAAAATTAACAGGGTGCGGTGGG + Intronic
1140070021 16:71641154-71641176 CAAAGTTAAAGAATTGAGGACGG + Exonic
1142837930 17:2603056-2603078 CAAAGATCACAAAGTGGGGAGGG - Intronic
1149933345 17:60778535-60778557 CAAAGTTAATAATGTGTGCATGG - Intronic
1150512585 17:65772647-65772669 CAAAACTAACACAGTGCAGAGGG - Intronic
1156096430 18:33538368-33538390 CAAATTTAACAAGGTGCCAAAGG + Intergenic
1156634914 18:39015791-39015813 CAAAGTTTACAACTTGCCGAAGG - Intergenic
1159764928 18:72477879-72477901 CAAAATTCACAAAATGTGGATGG + Intergenic
1163742869 19:19027117-19027139 CAAAAATAAAAAAGGGCGGAGGG + Intronic
1164310616 19:24042402-24042424 CAAAGTTTCCACAGTGTGGAAGG - Intronic
1166014538 19:39970378-39970400 CACAGTCAACAATGTGCCGAAGG - Intergenic
1167396940 19:49235742-49235764 AAAATATAACTAAGTGCGGATGG - Intergenic
1168613137 19:57816750-57816772 CAAAGTTTCCACAGTGTGGAAGG + Intronic
926909356 2:17836047-17836069 CCATGTTAACACAGTGAGGAAGG - Intergenic
926909362 2:17836093-17836115 CCATGTTAACACAGTGAGGAAGG + Intergenic
927990130 2:27441993-27442015 ACAAGTAAACAAAGTGCAGAGGG - Exonic
929692176 2:44084154-44084176 AATAGTTAACCAAGTGTGGAAGG + Intergenic
930159049 2:48134532-48134554 CAAAGTTAAAACAGTGCAAAAGG - Intergenic
930822019 2:55655835-55655857 CAAGGTTAACAGAGAGAGGAAGG - Intronic
933036052 2:77399861-77399883 CTAAGTGAACGAAGTGAGGAGGG - Intronic
935387218 2:102512891-102512913 CAAGGAAAAGAAAGTGCGGAAGG + Intronic
938155917 2:128939868-128939890 CAAAGGTTACATAGTGCGGCAGG - Intergenic
938743933 2:134259494-134259516 CAGGGTTAACAACGTGTGGATGG - Intronic
939281902 2:140074630-140074652 CAAAGCTTCCACAGTGCGGAAGG - Intergenic
944422638 2:199547539-199547561 CAAACTTAACAAAGTGATTATGG + Intergenic
948983514 2:241507194-241507216 CAGAGTCAAAAAAGTGGGGAGGG + Intronic
1169463863 20:5820649-5820671 CAAAGTTCACAAAGTGAAGAAGG + Intronic
1169630077 20:7621670-7621692 CAAAGTTTCCACAGTGTGGAAGG + Intergenic
1170679221 20:18510054-18510076 CAAAGTTAACAAAGTGCGGAAGG + Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1175556423 20:59861648-59861670 CTAAGTGAAAAAAGTGTGGAAGG + Intergenic
1177497079 21:21903392-21903414 CAAAGTTTCCACAGTGTGGAAGG - Intergenic
1178447655 21:32660296-32660318 CAAAGTTACCACAGTATGGAAGG - Intronic
1178644403 21:34373613-34373635 CAAAGGTAACTGAGTGGGGATGG - Intergenic
949525494 3:4899285-4899307 CAGAGTAAAGAAAGTGCAGAAGG + Intergenic
949648483 3:6127083-6127105 CAAAGTTTCCACAGTGTGGAAGG + Intergenic
951787907 3:26443180-26443202 GAAGGTTAACAAATTGAGGAGGG - Intergenic
952178027 3:30888148-30888170 CATATTTAACAAACTGCAGAAGG - Intronic
952249808 3:31641339-31641361 CAAAGTTATGAAAATGCGCAAGG - Intergenic
954232591 3:49228824-49228846 CAAAGTTTCCACAGTGTGGAAGG + Intronic
956195879 3:66652377-66652399 CAAAGTTTCCACAGTGTGGAAGG - Intergenic
956665821 3:71641218-71641240 CAATGTGAACAATGTGCAGAGGG - Intergenic
958457387 3:94348632-94348654 CAAAGCTTCCATAGTGCGGAAGG - Intergenic
960685632 3:120290664-120290686 CAAAGCTTCCACAGTGCGGAAGG - Intergenic
962996967 3:140639339-140639361 CAAGGTAAACAAAGAGCAGAAGG - Intergenic
965200209 3:165648829-165648851 CAAAGCTTACACAGTGTGGAAGG + Intergenic
965652502 3:170948056-170948078 CAAAGTTTCCACAGTGTGGAAGG - Intergenic
967622417 3:191649982-191650004 CAAAGTTTCCACAGTGTGGAAGG - Intergenic
974870750 4:67638108-67638130 CTAAGGTAAAAAAGTGCTGAAGG + Intronic
975295372 4:72728372-72728394 AAAAGTTAACAAACAGGGGAAGG + Intergenic
976846214 4:89490967-89490989 CAAAGTTTTCAAAGGGTGGAAGG - Intergenic
978241747 4:106524859-106524881 CAAAGCTTCCAAAGTGTGGAAGG + Intergenic
979814977 4:125089044-125089066 CAAAGTTAATAAATAGTGGAGGG + Intergenic
980338109 4:131501514-131501536 AAAAGAGAACAAAGTGGGGAGGG + Intergenic
980827200 4:138088137-138088159 CAAAGTTTCCACAGTGTGGAAGG + Intergenic
982080135 4:151781474-151781496 CCAATTTCACAAAGTGGGGATGG - Intergenic
982277416 4:153650883-153650905 CAAAGTGAACCAAATGGGGAAGG + Intergenic
985589925 5:759257-759279 CAGTGTTAACAAAGGGCGCAGGG - Intronic
987383874 5:17311365-17311387 CAAAGTTACCATAGCGTGGAAGG + Intergenic
988201624 5:28077011-28077033 CAAAGCTACCACAGTGTGGAAGG + Intergenic
989559810 5:42837204-42837226 CAAAGCTACCACAGTGTGGAAGG - Intronic
995229870 5:109747570-109747592 CAAAGGTAACAAAGAGCTGGGGG + Intronic
996815718 5:127570427-127570449 CAAAGCTACCACAGTGTGGAAGG - Intergenic
997158048 5:131579327-131579349 CAAAGTTTCCACAGTGTGGAAGG + Intronic
1001298956 5:170519722-170519744 CAAAGTCAAGAAAGGGAGGAAGG + Intronic
1005012955 6:21353397-21353419 CAAAGTTAAAATTGAGCGGAAGG - Intergenic
1007640728 6:43337472-43337494 CAAAGTCAACAAGGTCTGGAAGG + Exonic
1007955251 6:45912185-45912207 TAAAGTTCACAAAGAGCGAAGGG - Intronic
1009396951 6:63211299-63211321 CAAAGTTAACAAAGTTAACAAGG + Intergenic
1009872432 6:69468324-69468346 CAAAGCTTCCACAGTGCGGAAGG - Intergenic
1010249572 6:73694039-73694061 CAAAATTAGCCAAGTGTGGATGG - Intergenic
1012510172 6:99993382-99993404 CTAAGTTAACTAAGTGGGAATGG + Intronic
1012760351 6:103293908-103293930 CAAAGCTACCACAGTGTGGAAGG + Intergenic
1015021011 6:128475009-128475031 CAAAGTGAACCAAGAGAGGATGG - Intronic
1018323768 6:162641703-162641725 TAGAGTTAACAGAGGGCGGATGG - Intronic
1022584067 7:31588203-31588225 AAAAGTGAACAAAGAGTGGAGGG + Intronic
1024466057 7:49712167-49712189 CAAAGCTTCCACAGTGCGGAAGG - Intergenic
1024906043 7:54381599-54381621 CAAAATTAATAAAGTGGGGAAGG + Intergenic
1027391454 7:77708062-77708084 CAAATTTAACAAAGTTTGCAAGG - Intronic
1028511099 7:91627112-91627134 CAAAGCTTCCACAGTGCGGAAGG + Intergenic
1029979395 7:104864052-104864074 CAAAATTAACAAAATGTTGATGG - Intronic
1030599830 7:111581293-111581315 CAAAGTTTCCACAGTGTGGAAGG + Intergenic
1030951328 7:115793630-115793652 ATAAGCTAACAAAGTGAGGATGG + Intergenic
1033065222 7:138147041-138147063 CAAAGTTTCCACAGTGTGGAAGG - Intergenic
1033794199 7:144827955-144827977 CAAAGCTTCCAAAGTGTGGAAGG - Intronic
1034399279 7:150851324-150851346 CAAAGTTAATGGAGTGAGGATGG - Intronic
1037843811 8:22264655-22264677 CAAAGCTAACAATGTGGGAAGGG + Intergenic
1037903575 8:22702571-22702593 CAAAGTTAACATAAAGAGGAGGG - Intergenic
1039810718 8:41045775-41045797 CAAAGTTTCCACAGTGTGGAAGG + Intergenic
1040620960 8:49092284-49092306 CAAAATTACCAAAGAGCAGATGG - Intergenic
1040954778 8:52969342-52969364 CAAAGTTTCCACAGTGTGGAAGG + Intergenic
1042235215 8:66605409-66605431 GAAAATTAATAAAGTGAGGAAGG + Intronic
1043983813 8:86670756-86670778 CAAAGTTAAGACAGTACAGATGG - Intronic
1044064119 8:87678257-87678279 CAAATTTAACAAATTGCTGCAGG - Intergenic
1045101592 8:98850109-98850131 CACAGAAACCAAAGTGCGGAAGG - Intronic
1046684089 8:117205470-117205492 CAAAGTGAACAAAGTGGGCAGGG + Intergenic
1048292115 8:133189202-133189224 AAAAGTCAACAAATTGAGGATGG - Intergenic
1050206085 9:3197724-3197746 CATCGTTCACAAAGTGCAGAGGG + Intergenic
1051686471 9:19663464-19663486 CACAGTTGACAGATTGCGGAAGG - Intronic
1052120715 9:24713278-24713300 CAATGTTAACAAAATGAGAAAGG - Intergenic
1058379433 9:104362284-104362306 CAAAGTTTCCACAGTGTGGAAGG + Intergenic
1058786648 9:108394482-108394504 CAAAGCTTCCACAGTGCGGAAGG - Intergenic
1060149601 9:121279793-121279815 CAGAGTTGACAGAGTGCGGGAGG + Intronic
1186778698 X:12891727-12891749 CCAAGTTAACAATGTACTGAAGG + Intergenic
1188289519 X:28370266-28370288 CAAAGATAACAAAATTGGGAGGG - Intergenic
1190739490 X:53279980-53280002 CAAAGTCAAGAAAGAGAGGACGG + Intronic
1193342844 X:80371591-80371613 CAAAGTGAAGCAAGTGCTGAAGG - Intronic
1193708820 X:84855996-84856018 CAAAGCTTCCACAGTGCGGAAGG + Intergenic
1194121073 X:89964996-89965018 CAAAGCTTCCACAGTGCGGAAGG + Intergenic
1197388356 X:125827877-125827899 AAAAGTTAACAAAATGCAGCAGG + Intergenic
1197678958 X:129361952-129361974 CAAACATAACAGAATGCGGAAGG + Intergenic
1199009491 X:142742022-142742044 CAAAGTTAACAAACACCTGAGGG - Intergenic
1199134039 X:144230763-144230785 CAAAGCTACCACAGTGTGGAAGG + Intergenic
1199864940 X:151836315-151836337 CAAAGTTACCAAAGGAAGGATGG + Intergenic
1200309806 X:155066609-155066631 GAAAGTTTACAAATAGCGGATGG + Intronic
1200439062 Y:3189209-3189231 CAAAGCTTACACAGTGTGGAAGG - Intergenic
1201260830 Y:12157850-12157872 CAAAGTTTCCACAGTGTGGAAGG + Intergenic