ID: 1170681917

View in Genome Browser
Species Human (GRCh38)
Location 20:18533548-18533570
Sequence CTCCTAACAATGCTGTAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170681917_1170681920 -2 Left 1170681917 20:18533548-18533570 CCACTCTACAGCATTGTTAGGAG 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1170681920 20:18533569-18533591 AGGTTTAAATGAGTTGGTTCAGG 0: 1
1: 0
2: 5
3: 22
4: 658
1170681917_1170681921 17 Left 1170681917 20:18533548-18533570 CCACTCTACAGCATTGTTAGGAG 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1170681921 20:18533588-18533610 CAGGTGAAGCAGTTAGTGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 202
1170681917_1170681922 25 Left 1170681917 20:18533548-18533570 CCACTCTACAGCATTGTTAGGAG 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1170681922 20:18533596-18533618 GCAGTTAGTGCCTGGCACACTGG 0: 1
1: 1
2: 1
3: 31
4: 237
1170681917_1170681919 -8 Left 1170681917 20:18533548-18533570 CCACTCTACAGCATTGTTAGGAG 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1170681919 20:18533563-18533585 GTTAGGAGGTTTAAATGAGTTGG 0: 1
1: 2
2: 3
3: 29
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170681917 Original CRISPR CTCCTAACAATGCTGTAGAG TGG (reversed) Intronic
901168872 1:7240010-7240032 CTCCCAACAGTGTTGTAGTGGGG + Intronic
901801753 1:11712228-11712250 GTCCAAGCCATGCTGTAGAGTGG + Intronic
902636325 1:17737141-17737163 CTCCTAGCCATGGTGGAGAGGGG + Intergenic
903617008 1:24667007-24667029 TTCCTAACAAGGTTGGAGAGAGG + Intronic
904213718 1:28903072-28903094 CTCACAACAACCCTGTAGAGTGG - Intronic
906127078 1:43433256-43433278 CTTCTAACAACACTGGAGAGAGG - Intronic
911118024 1:94266150-94266172 CTGCTAGCATTGCTGTAGAAAGG - Intronic
911747599 1:101456706-101456728 CTTCTATCAATGCTGTTGAGAGG - Intergenic
912455605 1:109794799-109794821 GTCCTAACACTGCTGCACAGGGG - Intergenic
913020266 1:114782089-114782111 CTCTTAACATTGCTTAAGAGGGG - Intergenic
914770895 1:150683887-150683909 CTCATAACAATGATTTAGAAAGG - Intronic
917077358 1:171219211-171219233 CTTTTTACAATGCTGAAGAGTGG - Intergenic
919799362 1:201344138-201344160 CTCCTAGCAATGCTGGCTAGGGG + Intergenic
920832941 1:209481622-209481644 CTCCTCCCAGTGCTGTAAAGCGG - Intergenic
921558726 1:216630723-216630745 CTCCTGACAACACTGCAGAGGGG - Intronic
923854380 1:237829883-237829905 CTCCTAAGCACCCTGTAGAGGGG - Intronic
1064061959 10:12145721-12145743 ATCCTAACAAGGCTGGAGAGAGG - Intronic
1064352635 10:14590654-14590676 CTCTTAACAATGAAGTTGAGAGG + Intronic
1065850250 10:29781804-29781826 CTCCCAAAAATTCTGTAAAGGGG - Intergenic
1066136010 10:32446721-32446743 CTCCTAACAATGCTAGGAAGTGG - Intronic
1068464484 10:57371215-57371237 CTCCTAATAATACTGTTGATAGG - Intergenic
1071727079 10:88209844-88209866 ATCCTCAAAAAGCTGTAGAGTGG + Intergenic
1071965450 10:90847212-90847234 CACCTCACAATGTTGTAGAGGGG + Intronic
1076181366 10:128411455-128411477 TTTCTAACAGAGCTGTAGAGAGG + Intergenic
1076817087 10:132920335-132920357 CTCCTCACAGAGCTGCAGAGTGG + Intronic
1077710120 11:4527979-4528001 CTCCAAACTATTCTCTAGAGTGG - Intergenic
1078901370 11:15645514-15645536 CTTCTAACAATCCTGTAGGTAGG - Intergenic
1083376804 11:62230141-62230163 CTCCCAAAAATTCTGTAGTGGGG + Intergenic
1084580564 11:70020470-70020492 CTCCTGCCAAGGCTGGAGAGAGG - Intergenic
1085358555 11:75863715-75863737 CTCCAAAGAATACTGTAGAATGG + Intronic
1085809014 11:79663558-79663580 ATTCTAACAATGCAGAAGAGTGG - Intergenic
1086483728 11:87274072-87274094 CTCCTGACCATCCTTTAGAGTGG + Intronic
1087045768 11:93842735-93842757 CTCCCAACAATTCTTTTGAGGGG + Intronic
1090213948 11:124943762-124943784 CTTCTAACAACGCTGTGCAGTGG + Intergenic
1097143934 12:56926619-56926641 CTCCTAACAATCCATGAGAGAGG + Intronic
1097733538 12:63155459-63155481 CCCCTAACAATGCTGAAAACAGG + Intergenic
1101377097 12:104180741-104180763 ATCCTAGCAATGGTGAAGAGTGG - Intergenic
1105771962 13:23620577-23620599 CTTCTAACAATTCTGCAGGGTGG - Intronic
1106962252 13:35012406-35012428 CTCCCAACAATGTTGTATTGGGG + Intronic
1108780870 13:53830899-53830921 CTGCTAACCATGCTTTGGAGAGG + Intergenic
1111379501 13:87428402-87428424 CTCCTAGCAATGCTTTGGAAGGG + Intergenic
1116334048 14:43634426-43634448 CTCCTAACACTGTTGTAATGGGG + Intergenic
1116748911 14:48856692-48856714 CTCCTAACAAAGATGTAGCATGG + Intergenic
1118741103 14:68739860-68739882 CTTCTGACATTCCTGTAGAGAGG + Intergenic
1120486131 14:85115195-85115217 CTCCTAATAATGGAATAGAGAGG + Intergenic
1120504460 14:85337416-85337438 CTCCTAACAATTCTTAATAGGGG - Intergenic
1121761130 14:96446105-96446127 CTCACAACAATGCTTTAGGGAGG - Intronic
1121896803 14:97656322-97656344 TTCCTAATACTGCTGCAGAGTGG + Intergenic
1129229405 15:74188533-74188555 CTCCCAACAGCGCTGTGGAGGGG - Intronic
1130305208 15:82708879-82708901 GTCCTCACGATGCTCTAGAGGGG - Intronic
1130369708 15:83274618-83274640 CTCCTCACAGTACTGTAGTGAGG - Intronic
1135835976 16:25825628-25825650 CTGCACACAATGCTGTTGAGTGG - Intronic
1139777911 16:69328762-69328784 TTCCTAACAATTCTGTATGGAGG - Exonic
1142836032 17:2587461-2587483 CTCCTATCACGCCTGTAGAGGGG - Intergenic
1146901211 17:36590773-36590795 CTCTTAACAGTGGTGAAGAGGGG - Intergenic
1150855525 17:68748764-68748786 GTCCTAACCTTCCTGTAGAGAGG - Intergenic
1152041243 17:77905236-77905258 CTCTTCACAAGGTTGTAGAGAGG - Intergenic
1155314794 18:24560821-24560843 CTCCTAAGAATACTTTAGTGAGG + Intergenic
1157144850 18:45151488-45151510 CTCAAAACAATGCTGTTAAGTGG - Intergenic
1158109526 18:53925529-53925551 CTCCTGACATTGCTCTGGAGGGG - Intergenic
1165392907 19:35548581-35548603 CTCCAAACAATGAGGAAGAGTGG - Intergenic
926738909 2:16094901-16094923 CCACTAACAGTGCTGAAGAGTGG + Intergenic
935349869 2:102143565-102143587 CTCCTCACAAGACTGTAGGGAGG - Intronic
936688073 2:114852006-114852028 CTCATAACCATGGTGTATAGAGG + Intronic
936785332 2:116087708-116087730 CTCCTAACAAAGCTTTAAAAGGG + Intergenic
937810570 2:126195123-126195145 CTCCAAGCAGTGCTGTAGATGGG + Intergenic
938745827 2:134277248-134277270 CTCCTAACAATACTGTGAAATGG - Intronic
939582457 2:143966927-143966949 CTCCCAAGAGTTCTGTAGAGAGG + Intronic
944332845 2:198492557-198492579 CTCCTAACAATGATCTACAAAGG + Intronic
948096853 2:235342274-235342296 CTCCTAAAAATCCTGTGAAGTGG - Intergenic
1168819632 20:764207-764229 CTCCTAACAGGGCTGCACAGTGG + Intronic
1168875960 20:1172356-1172378 CTCATAACAATCCTACAGAGGGG - Intronic
1170681917 20:18533548-18533570 CTCCTAACAATGCTGTAGAGTGG - Intronic
1175030427 20:55948037-55948059 CTCCCAAGAAGGCTGTGGAGAGG + Intergenic
1177477584 21:21644428-21644450 AGCCTAACAATGCAGTAGAAAGG + Intergenic
1178882248 21:36459076-36459098 CTCCTAGCAATATTGAAGAGTGG - Intergenic
1180393477 22:12306484-12306506 AGCCTAACCATGTTGTAGAGAGG + Intergenic
1180406271 22:12558284-12558306 AGCCTAACCATGTTGTAGAGAGG - Intergenic
1180624182 22:17182928-17182950 CTTTTAACAATGCTAAAGAGAGG + Intronic
1182309760 22:29396215-29396237 CTCCTAACACTGTTGCAGTGGGG - Intronic
1185089135 22:48756190-48756212 CTCCTGCCAATGCTGCAGGGAGG + Intronic
950225830 3:11233812-11233834 CTCCTAAAAATGCTGGGGTGGGG - Intronic
951926902 3:27917290-27917312 CTCCTAAAAGTTCTCTAGAGTGG + Intergenic
953700555 3:45192239-45192261 CTCCTAACAACCCTGTGCAGTGG - Intergenic
953745973 3:45574346-45574368 GTCCTATCAAGGCTGTAGTGTGG - Intronic
960360432 3:116704369-116704391 CTCCCAACACTGCTGTATTGGGG + Intronic
964869201 3:161294412-161294434 TTCCTCACAAGGCTGTTGAGAGG + Intergenic
965209775 3:165770028-165770050 TTCCTGACATTGCTGAAGAGGGG - Intergenic
967539550 3:190649509-190649531 CTCCTAATGGTGCTATAGAGAGG + Intronic
967615528 3:191560818-191560840 CTCCCAACAATGCTGCATTGGGG - Intergenic
969042991 4:4315524-4315546 CTCCTGACACTGCTGCAGAAAGG - Intronic
969105877 4:4806781-4806803 CTACTCACAATGCAGTAGTGGGG - Intergenic
969345222 4:6565626-6565648 CAGCCATCAATGCTGTAGAGAGG + Intergenic
970715900 4:18922512-18922534 GTCCACACAATGCTGGAGAGTGG - Intergenic
972703089 4:41513526-41513548 CTCCTAACTCTTCTTTAGAGAGG + Intronic
974558058 4:63478282-63478304 ACCCTGGCAATGCTGTAGAGAGG + Intergenic
976067530 4:81205781-81205803 CTCCTAACATTGGTGTAGTGTGG + Intronic
977069992 4:92373438-92373460 CTTCTAACAATGTTGTAGCCTGG + Intronic
978426815 4:108592083-108592105 CCCCTACCACTGGTGTAGAGGGG + Intergenic
978508365 4:109486053-109486075 CTCCAAACAGTGCTACAGAGGGG - Intronic
980309983 4:131114650-131114672 CTTTTTGCAATGCTGTAGAGTGG + Intergenic
984150659 4:176126111-176126133 CTCCTAACAATGTTGCATTGGGG + Intronic
985583824 5:716020-716042 CTTCTCACAATGCTTCAGAGAGG - Intronic
985597330 5:800319-800341 CTTCTCACAATGCTTCAGAGAGG - Intronic
988431542 5:31124653-31124675 CTCCAAACAATGCGGTCAAGTGG + Intergenic
992717797 5:79528598-79528620 CTACTCAAAATGCAGTAGAGTGG + Intergenic
993951271 5:94178685-94178707 CTCCTTACAATGCTATAGACAGG + Intronic
996153677 5:120071688-120071710 TTCATAAAAATGCTGTAAAGGGG + Intergenic
998762108 5:145443648-145443670 ATCCTGAAAATGCTGTACAGAGG - Intergenic
998881089 5:146645694-146645716 GTCCTAACAACCCTGTACAGTGG - Intronic
999373722 5:151071900-151071922 CACCTAACTAAGCTGGAGAGAGG + Intronic
999640408 5:153666705-153666727 CTCATAGCAATCCTGTAAAGTGG - Intronic
1005173125 6:23011410-23011432 CTCCCCACAATGCGTTAGAGAGG + Intergenic
1006425646 6:33961335-33961357 CTCGTAACAACCCTGTAGACGGG + Intergenic
1008418872 6:51273642-51273664 TTCCCAACAATGCAGAAGAGAGG + Intergenic
1011499892 6:87976353-87976375 CTCAAAACAATGCTGTAATGTGG - Intergenic
1012945182 6:105458219-105458241 CTGCTGACAAAGCTGTGGAGAGG - Intergenic
1013112227 6:107073322-107073344 CTCCTGTGAGTGCTGTAGAGGGG - Intronic
1013858749 6:114608032-114608054 CAGCCAGCAATGCTGTAGAGTGG - Intergenic
1014298716 6:119652957-119652979 CTACTTACAATGCTTGAGAGCGG + Intergenic
1015026089 6:128534361-128534383 CTCATAATAATACTCTAGAGCGG + Intergenic
1015203368 6:130607145-130607167 CTCCTAACACTGTTGTACAGAGG - Intergenic
1015569843 6:134609522-134609544 ATTCAAACAATTCTGTAGAGAGG + Intergenic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1017773715 6:157663402-157663424 CTCCTAGCAATGCTGGACAGAGG + Intronic
1018054274 6:160038248-160038270 ATCCTAACATTGCTGATGAGTGG + Intronic
1019883301 7:3882327-3882349 CTCCTGAGAATGCTGCAGGGAGG + Intronic
1020368788 7:7410762-7410784 CTCATAACCATGCTGTACAATGG - Intronic
1021291607 7:18852022-18852044 CTTCTAACAAGGCTGCTGAGGGG + Intronic
1023090443 7:36613215-36613237 CTTCTTAAAATTCTGTAGAGAGG + Intronic
1024316377 7:48021841-48021863 CTCCAAACTATCCTGCAGAGTGG - Intronic
1024868721 7:53935797-53935819 CTCTTAACCATGCTGTACATTGG - Intergenic
1025951775 7:66151091-66151113 CTCCCAACAATGCTGCTAAGGGG - Intronic
1027638174 7:80701900-80701922 CTCCAAACAATGATGTTAAGAGG - Intergenic
1028892808 7:96007707-96007729 CTTTTAAAAATGCTGTACAGAGG - Intronic
1028978536 7:96941087-96941109 CTTCTAACACTGTAGTAGAGTGG - Intergenic
1030213927 7:107023638-107023660 CTCCAAGCAATGCTGTGGAGAGG + Intergenic
1039922778 8:41904990-41905012 CTCCTAATACTGCTGTAGAAAGG - Intergenic
1042043400 8:64620389-64620411 CTGCTGACAATGATGTACAGTGG + Intronic
1048234718 8:132678288-132678310 AACCTAACAATGCTGTACACTGG + Intergenic
1048834632 8:138506651-138506673 CTCCTGAGAATACTGTAGACAGG + Intergenic
1050944342 9:11498993-11499015 TTCCTATCAATGCTATAGACTGG - Intergenic
1052489820 9:29151100-29151122 TTCATAACAATGCTGTAAATAGG - Intergenic
1058381672 9:104383886-104383908 CTCCAATCAATGCTTCAGAGAGG + Intergenic
1060304849 9:122402219-122402241 CTCCTAACAATTTTGTAGGTAGG + Intergenic
1188740549 X:33773827-33773849 TTCCTAGCAATGGTGTAGAAGGG + Intergenic
1198233886 X:134718272-134718294 CTCCTAATAAAGCTGTGGAGTGG + Intronic
1198630227 X:138629196-138629218 CTATTAACATTGCAGTAGAGTGG - Intergenic
1201374008 Y:13296318-13296340 CTCCTCACAATCCTGGAGACTGG - Intronic