ID: 1170682955

View in Genome Browser
Species Human (GRCh38)
Location 20:18543130-18543152
Sequence GCCCGATGTGCTCCGGTGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170682952_1170682955 -2 Left 1170682952 20:18543109-18543131 CCGAGCGGAGTCAGAGGAGGGGC 0: 1
1: 0
2: 1
3: 13
4: 210
Right 1170682955 20:18543130-18543152 GCCCGATGTGCTCCGGTGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170682955 Original CRISPR GCCCGATGTGCTCCGGTGGC TGG Exonic
900114626 1:1023226-1023248 CTCCGATCTGCTCCGTTGGCCGG + Intronic
901446855 1:9313757-9313779 GCCCGCTGTGCTTCAGTGGCTGG + Intronic
903643889 1:24879204-24879226 GCCCAGTGTGCCCAGGTGGCTGG - Intergenic
908780349 1:67685187-67685209 GCCCTTTGTCCTCCAGTGGCTGG + Exonic
1062883462 10:997714-997736 GCCAGCGGGGCTCCGGTGGCAGG + Intronic
1072708784 10:97701929-97701951 ACCAGATGTGCTCCAGGGGCCGG - Intergenic
1074772264 10:116742056-116742078 GCGCGATGGGCTGCGGAGGCCGG - Intronic
1076765041 10:132628444-132628466 TCCAGATGTGCTCTGGTGGCGGG + Intronic
1091857882 12:3753604-3753626 TCCCGAGGTGCTCCGGCTGCAGG + Intronic
1094844217 12:34354375-34354397 GCCCAAGGTGCTCCGTGGGCGGG + Intergenic
1096782696 12:54000273-54000295 GCGGGATGAGCCCCGGTGGCCGG - Exonic
1101363553 12:104050208-104050230 TCCAGATGTGCTCGGCTGGCCGG + Intronic
1105301161 13:19136028-19136050 GCTCAATGTGCTCCAGTGGGTGG + Intergenic
1115981341 14:39055163-39055185 TCCAGATGTGCTTAGGTGGCTGG - Exonic
1127433276 15:58933165-58933187 GCACGCTGGGCTGCGGTGGCCGG + Intronic
1138514591 16:57529078-57529100 GCCCCATGCGCTCCGGCGACGGG + Exonic
1142199253 16:88753314-88753336 GGCAGGTGTGCTCCGGGGGCGGG - Intronic
1142903893 17:3029751-3029773 TCCCGCTGTGCCCCGCTGGCAGG - Intronic
1146009225 17:29180312-29180334 GCCGGGCGGGCTCCGGTGGCCGG - Exonic
1149655744 17:58308832-58308854 CCCGGAGGTGCTCCCGTGGCCGG - Exonic
1151116417 17:71740324-71740346 GCCCCATTTGCTCAGGTGGTAGG - Intergenic
1154216404 18:12419809-12419831 GCCCCAGCTGCTCCGGAGGCTGG + Intronic
1166389818 19:42402606-42402628 CCACGATGTGCACAGGTGGCAGG + Exonic
926027340 2:9556243-9556265 GCCCAGTGTGCTCAGGTGGGAGG + Intergenic
944128617 2:196321172-196321194 GCCAGATGTGCCCCTGTGGTGGG + Intronic
947065198 2:226216799-226216821 GCCCTAGGTGCTCCAGGGGCAGG - Intergenic
947669202 2:231925965-231925987 GGCCGATGTTCTCCGGAGGCTGG + Intronic
1170682955 20:18543130-18543152 GCCCGATGTGCTCCGGTGGCTGG + Exonic
1180857899 22:19059739-19059761 GCAGGGTGTCCTCCGGTGGCTGG - Intronic
966402689 3:179563268-179563290 GCCGGGTGGGCTCCGGGGGCGGG - Intronic
966630390 3:182067663-182067685 GCACCATGTTCTCCAGTGGCTGG + Intergenic
969265007 4:6058682-6058704 GCTCAATGTGCTCTCGTGGCAGG + Intronic
969707242 4:8818708-8818730 GGCCCATGTGCTCCTGTGGCTGG - Intergenic
976797088 4:88946306-88946328 GTCCGGTGTGCTCTTGTGGCTGG + Intronic
985135021 4:186777894-186777916 GCCCCATGTGCTCCCTGGGCAGG + Intergenic
995650250 5:114361662-114361684 GCCCGACGTGCTGCAGTGGCTGG + Intronic
1002106280 5:176880830-176880852 CCCCTATGTGCCCCGGCGGCCGG - Exonic
1003474060 6:6465195-6465217 GCCCCCTGTTCTCCAGTGGCAGG - Intergenic
1020145977 7:5643402-5643424 GCAGGATGTGCTCCCGGGGCAGG + Intronic
1029708273 7:102286694-102286716 GCCCGAGCGGCGCCGGTGGCCGG - Intronic
1032012931 7:128358800-128358822 GCCCCATGTGCTCCCTTTGCAGG - Exonic
1035396962 7:158540861-158540883 GGCCAATGTGCCCCAGTGGCTGG + Intronic
1036990223 8:13584168-13584190 GCTGGATTTGCTCCTGTGGCTGG + Intergenic
1037622437 8:20576544-20576566 TCCCGGTGTGCTCCATTGGCTGG + Intergenic
1040610514 8:48977838-48977860 GCCCCATGTGCCCTGGGGGCCGG - Intergenic
1041362520 8:57067714-57067736 GCCCGAGGTCCTCAGGTAGCAGG - Intergenic
1044572304 8:93734070-93734092 TCCGGAAGTGCTCCGGGGGCGGG + Exonic
1049399453 8:142418412-142418434 GTCCCATTTGCTCCTGTGGCAGG + Intergenic
1061193651 9:129095965-129095987 GCCCCAGGTGCCCCGGGGGCTGG - Intronic
1061410551 9:130418926-130418948 GCCCGATGGGAGCCTGTGGCTGG + Exonic
1185453432 X:295273-295295 GCCCCGTGTCCTCCGGAGGCAGG + Intronic
1185975986 X:4720525-4720547 GCCCAATGTGCTTGGGTTGCAGG - Intergenic