ID: 1170690974

View in Genome Browser
Species Human (GRCh38)
Location 20:18614814-18614836
Sequence CAGGAGGAAGGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16798
Summary {0: 2, 1: 12, 2: 265, 3: 2440, 4: 14079}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170690974 Original CRISPR CAGGAGGAAGGGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr