ID: 1170694365

View in Genome Browser
Species Human (GRCh38)
Location 20:18645303-18645325
Sequence CTGCAGAAATGGAAACAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 398}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170694365 Original CRISPR CTGCAGAAATGGAAACAAGG AGG Intronic
901096415 1:6683852-6683874 ATGCAGAGATGGAAATATGGAGG - Intronic
901176695 1:7306513-7306535 CTACAGTAATGAAAACAATGTGG - Intronic
903670316 1:25031431-25031453 CTGGAGAGATGGAAAGATGGAGG + Intergenic
903678656 1:25082744-25082766 CTGCAGGCATGGGAACAAGATGG - Intergenic
904864369 1:33565816-33565838 CAGCACAAATGGACAAAAGGTGG + Intronic
907046644 1:51303645-51303667 CTGCAGGCAGGGAAACAAGGTGG - Intronic
907247518 1:53117583-53117605 CTGCAGAGATGCAAACAATCTGG - Intronic
907310588 1:53536840-53536862 ATGCAGAAAGGAAAACCAGGTGG + Intronic
907388209 1:54139542-54139564 CTGCAATAGTGGAAACAAGCGGG + Exonic
908160611 1:61404292-61404314 CTAAAGAAATGGAAAAAAAGAGG - Intronic
908267146 1:62390546-62390568 TTAAAGAAATGGAAACAAAGAGG - Intergenic
908562512 1:65320878-65320900 CTGAAGAAACAGAAACAAGCAGG + Intronic
909681970 1:78301644-78301666 CTGCAAAAATGGAAACAAATGGG - Intergenic
910543129 1:88383777-88383799 ATGCACATATGGGAACAAGGAGG - Intergenic
911397904 1:97335190-97335212 CTGCAGCCATGGAAAGAAGAGGG - Intronic
912373601 1:109192588-109192610 CTGGAGACAAGGAAACAAGAGGG - Intronic
912571146 1:110623078-110623100 CTGCAGTAATAAAAACAATGTGG + Intronic
912831902 1:112960038-112960060 CTGGAAAAATAGAAACACGGTGG + Intergenic
913328156 1:117645830-117645852 GTGGAGAACTGGAAACAACGTGG + Intergenic
913517402 1:119616123-119616145 CTGCATAAATGGAGACAGGCAGG + Intergenic
914442956 1:147723061-147723083 ATGGAGAAATGGAAACAGAGAGG - Intergenic
914502842 1:148262738-148262760 CTGCAAAGAGAGAAACAAGGTGG - Intergenic
915526994 1:156482022-156482044 CAGGAGAGATGGAAACAAAGAGG + Intronic
915734799 1:158077968-158077990 CTGCAGAAACAGAAAGAATGAGG - Intronic
917443291 1:175085390-175085412 GTGCAGACCTGGAAACAAGCAGG - Exonic
918208978 1:182334114-182334136 CTGTAGTGATGGAAACAAGAAGG - Intergenic
919513675 1:198495213-198495235 CTGTAGAAATGCTAACAATGAGG + Intergenic
922929449 1:229377417-229377439 GTACAGAAAAGGAAACAAGAGGG + Intergenic
924028494 1:239863692-239863714 GTGCAGAAAAAGAAAGAAGGTGG + Intronic
1064160418 10:12940776-12940798 CTGCAGAACTTGGAACATGGAGG - Intronic
1065591497 10:27266806-27266828 CTGCACAAAAGGACAGAAGGCGG - Intergenic
1066244956 10:33573781-33573803 CTGCAGAGGTGGAAACAGGACGG + Intergenic
1067733025 10:48826920-48826942 CAGCAGACAAGGAAACAAGTGGG - Intronic
1068550143 10:58398301-58398323 CTGAAGAAATGAAATCAAGCAGG + Exonic
1069541383 10:69296725-69296747 CTGCAAAAATGGGAAAAAGCTGG + Intronic
1070146460 10:73777430-73777452 CTGCAGTTATGGAAACAGTGTGG + Intronic
1070688208 10:78505389-78505411 CTGCAGCAATGGAAAGACAGGGG + Intergenic
1072008677 10:91284856-91284878 CTGCAGAATGGGAAAGAATGTGG + Intergenic
1072078955 10:92008989-92009011 TTGGAGAAATGTAAACAAGCTGG + Intronic
1072534000 10:96345980-96346002 CTATAGAAATGGAAAGAAGGAGG - Exonic
1072567569 10:96630182-96630204 CTGAAGAAGTAGAAATAAGGAGG - Intronic
1073151170 10:101312620-101312642 CTACAGAAATGGACAGAATGAGG - Intergenic
1073514687 10:104065860-104065882 CAGGAGAAAAGGCAACAAGGTGG - Intronic
1073981975 10:109164325-109164347 CATCAGAAAAGGAAACATGGAGG + Intergenic
1074294197 10:112168006-112168028 CAGCAGAGATGGCAACACGGTGG + Intronic
1074642388 10:115401488-115401510 CTGCTGAAATGGAGAAAATGAGG + Intronic
1075055954 10:119218462-119218484 CTTCTGAAATGGAAACAAGCTGG + Intronic
1076106369 10:127826859-127826881 CTGCAGAAACTGAGACACGGTGG - Intergenic
1076318386 10:129559894-129559916 CTGCAGAAATGGACAAATGCAGG + Intronic
1076617027 10:131761900-131761922 AAGAAGAAATGGAAAGAAGGAGG + Intergenic
1077223727 11:1428636-1428658 CTCCAGAAAAGGAAAGAAAGTGG - Intronic
1077448331 11:2614773-2614795 CTGCAGTAATCAAAACAATGTGG - Intronic
1078484242 11:11706909-11706931 CTGGCGAAATGGAGACAGGGAGG + Intergenic
1078632088 11:13011638-13011660 CTGCAGAAATGTAAACAGCCAGG - Intergenic
1078656665 11:13247000-13247022 CTGCCCAACTGGAAACAAAGGGG + Intergenic
1078808563 11:14733858-14733880 CTGCAGAAAGGGAAAAAAAGGGG + Intronic
1078939634 11:15987564-15987586 CTGCCAAAATGGAAACAGAGAGG + Intronic
1079089059 11:17468049-17468071 CTTCAGAAATGGAAGCAGGGTGG + Intronic
1079312064 11:19375678-19375700 CTGCACAAGTGAAAACAAGAGGG - Intronic
1080294633 11:30712819-30712841 CTGCCCAAATGACAACAAGGAGG - Intergenic
1081298335 11:41419749-41419771 ATGCAAAAATGGAAACACAGAGG + Intronic
1083731114 11:64653271-64653293 CTCCAGAATTGGCCACAAGGGGG - Intronic
1083958023 11:65997419-65997441 CTGCAGAGCTGGTAACAGGGAGG + Exonic
1085700041 11:78737656-78737678 TTGGAGAAAAGGAAAAAAGGAGG - Intronic
1086103113 11:83122211-83122233 CTGGAGAAATGGAATGAAAGAGG - Intergenic
1088936971 11:114412032-114412054 CTCCAGAAATGGTAACTATGGGG - Intronic
1089045368 11:115497644-115497666 CTTCTGAAATTTAAACAAGGAGG + Intronic
1091061771 11:132470166-132470188 ATGCAAAAATGGAAGCATGGAGG + Intronic
1091468311 12:704879-704901 CTTTGGAAAAGGAAACAAGGTGG - Intergenic
1092219746 12:6704908-6704930 CTGAGAAAATGGAAACAAGCAGG + Intergenic
1092329848 12:7574808-7574830 CTGAGGAAATGGAAGCAATGTGG - Intergenic
1092955873 12:13549303-13549325 CTGAAGAAAGGGAAGCATGGGGG - Exonic
1093542401 12:20303004-20303026 CTGCAGGAATGCTAGCAAGGTGG - Intergenic
1093805330 12:23425564-23425586 CCACAGACATGGAAACAAAGAGG + Intergenic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1094738660 12:33263493-33263515 CTGCATAAATGAAAACAACATGG - Intergenic
1095705110 12:45228636-45228658 CTGGAGACATGGAAATACGGAGG + Intronic
1095965657 12:47865260-47865282 TTGGAGAAATGGAGACCAGGGGG - Intronic
1096609494 12:52791542-52791564 CTCCACAAATGGAGACAAGATGG - Intronic
1097725561 12:63071750-63071772 CTGAGGAAATGGAAGCCAGGAGG + Intergenic
1097878997 12:64670452-64670474 ATGCAGAAAGAGAAACAAAGTGG + Intronic
1097915511 12:65016902-65016924 CTGAAGAAATGGAAAAAACATGG + Intergenic
1098242037 12:68477855-68477877 CTGGAGAAAGGGAATAAAGGAGG - Intergenic
1098370627 12:69756736-69756758 CTGCAGAAATGAAATCATGATGG + Intronic
1098773009 12:74578627-74578649 CTGCAGTAGTGGAAAAAAGTTGG - Intergenic
1100635290 12:96429704-96429726 TTGGAGAAATGGAAACAAAAGGG + Intergenic
1100918710 12:99457162-99457184 CTGCATAAATGAAAAAAAGATGG + Intronic
1101282225 12:103270192-103270214 CTACAGAAATGCAGAAAAGGAGG + Intronic
1102571067 12:113827354-113827376 CTCCAGAAATGCAAAAATGGTGG - Intronic
1102781718 12:115571291-115571313 CTGGAGCAATGTAAGCAAGGAGG + Intergenic
1103185918 12:118957176-118957198 CTGCAGAGATGGAAAAAACTAGG + Intergenic
1103893723 12:124259314-124259336 CTGCAGAAGGGAAAACAAGACGG + Intronic
1104541728 12:129672039-129672061 GTGCAAAAATGCAAATAAGGTGG + Intronic
1106176607 13:27337339-27337361 TTGCAGAAATTGAGACAATGTGG + Intergenic
1106419754 13:29576550-29576572 CTGCAGAAAGTGAGAGAAGGAGG + Intronic
1107025586 13:35798176-35798198 CTAGAGAAATGGAGACCAGGAGG - Intronic
1108749781 13:53436878-53436900 CTCCAGAAATGCAAATAGGGTGG + Intergenic
1111530203 13:89526632-89526654 CTGCAGACATAGAAGCAAGCTGG - Intergenic
1112015501 13:95328062-95328084 CAGCAGAGATGGAAACAATACGG + Intergenic
1112924543 13:104657540-104657562 AGGGAGAAAGGGAAACAAGGAGG - Intergenic
1113012879 13:105790940-105790962 CTTCATGGATGGAAACAAGGGGG - Intergenic
1114275527 14:21140331-21140353 CTGCAGTAATTAAAACAATGTGG - Intergenic
1116257159 14:42571124-42571146 CTGCAGGGATGGAAGCAGGGAGG - Intergenic
1116680976 14:47969529-47969551 CTACAGTAATGAAAACAACGTGG - Intergenic
1117444614 14:55791856-55791878 TTGGGGAAAGGGAAACAAGGAGG - Intergenic
1117538915 14:56727714-56727736 CTGCAGATATGGAAATAAGAAGG + Intronic
1118496681 14:66314459-66314481 GTTCAGAAAGGGAAATAAGGAGG - Intergenic
1118865076 14:69696582-69696604 CTGAAGATGTGGAAAGAAGGAGG - Intronic
1119529270 14:75348265-75348287 CTCCAGAAATGGAAATGAGGAGG - Intergenic
1119763029 14:77166727-77166749 CTTCAGTAATTGAAACAATGTGG - Intronic
1120273705 14:82346637-82346659 ATCCAGAAATGAAAACCAGGAGG - Intergenic
1120933580 14:89872545-89872567 CTGGAGGTATGGAAACAAAGTGG + Intronic
1121592886 14:95132533-95132555 CAGCAGAAATGGAAAAAGGACGG - Exonic
1121913066 14:97809918-97809940 CTGCAAAAATGGAAATAATGAGG + Intergenic
1124020241 15:25914736-25914758 CTGCAGTAATGAAAACAATATGG - Intergenic
1124230587 15:27942710-27942732 CTGAAGAAATGAAATCATGGGGG - Intronic
1124681700 15:31737357-31737379 TTACAGAAATGGAATCAAGATGG + Intronic
1125415825 15:39451381-39451403 CTGCAGAAATGAAACCATTGAGG - Intergenic
1126245366 15:46498786-46498808 CTGCACAAATGGAAAGGAGTAGG - Intergenic
1126388693 15:48121575-48121597 ATTCAGAAATAAAAACAAGGAGG + Intronic
1126829652 15:52588294-52588316 CTGCAAAAATGCAATCAATGGGG + Intronic
1126905478 15:53359992-53360014 TTGCATAAATGGAAACCATGAGG - Intergenic
1129030746 15:72615963-72615985 CAGCAGAAAGCGAAACCAGGTGG - Intergenic
1129826243 15:78636949-78636971 GTGCAGAAATGGGTACGAGGTGG + Intronic
1129835656 15:78703764-78703786 CAGCAGAAAGTGAAACCAGGTGG - Intronic
1129852825 15:78804345-78804367 CTGCAGAGAGGGAAAAGAGGGGG - Intronic
1130015434 15:80182509-80182531 CTGCAGAAATGGGAGCAAAATGG - Intronic
1131571607 15:93543046-93543068 CAGCAGCACTGGAAACAAGAGGG - Intergenic
1131884091 15:96891029-96891051 CTGCTGTGATGGAAAAAAGGAGG + Intergenic
1132000216 15:98171633-98171655 CTCCAGAAATGGTAACTATGGGG - Intergenic
1132101711 15:99028327-99028349 CTGCTGACGTGGAAACAAGGTGG + Intergenic
1132226726 15:100148367-100148389 CTGCAGAAAATGATACTAGGTGG - Intronic
1133160719 16:3909831-3909853 CTGCAAAAAAGAATACAAGGCGG - Intergenic
1133676213 16:8075375-8075397 CTGCAGGGATGGAAACCCGGAGG + Intergenic
1134046582 16:11105429-11105451 CTGGACACATGGGAACAAGGAGG + Intronic
1134228611 16:12411742-12411764 CTGCAGAGAAAGGAACAAGGAGG + Intronic
1134855992 16:17519643-17519665 CTGCAAAAATGAAAAGAAGACGG + Intergenic
1134915196 16:18063464-18063486 CTTCAAAAAGGGTAACAAGGTGG - Intergenic
1137366081 16:47860862-47860884 ATGCAGAAATGGAAAGAATGTGG - Intergenic
1138070926 16:53992284-53992306 CTGCAGAAATGGAAATAGAGTGG + Intronic
1139168095 16:64594911-64594933 CTGAAGACCTGAAAACAAGGAGG - Intergenic
1139229058 16:65264779-65264801 CTGCACAACTGGAAAGAAAGGGG - Intergenic
1139306873 16:65994114-65994136 CTGAAGCAATGGAGAAAAGGAGG + Intergenic
1140607898 16:76563283-76563305 CTGGAAGATTGGAAACAAGGAGG - Intronic
1141120618 16:81352563-81352585 CTACAGAAAGGAAAACAAGAGGG - Intronic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142546777 17:709686-709708 CTGAAAAAATGGAAACGAAGCGG + Intronic
1143301347 17:5912792-5912814 CAGCAGAAATGAGATCAAGGAGG + Intronic
1143500829 17:7337499-7337521 CTGCAGAGAAGCAAAAAAGGTGG + Intronic
1143737350 17:8922118-8922140 CTGGAGAATAGGAAAGAAGGAGG + Intronic
1144308009 17:13986796-13986818 CTGGAGCAATGTAACCAAGGAGG - Intergenic
1144447557 17:15344921-15344943 GTGCTGGAATGGAAACAAAGTGG + Intergenic
1145290218 17:21538260-21538282 CTACAGAAATCAAAACAATGTGG + Intronic
1146498714 17:33345923-33345945 CAGCAGAGACAGAAACAAGGAGG + Intronic
1148571512 17:48673336-48673358 CTACAGTAATGAAAACAATGTGG + Intergenic
1148913524 17:50955915-50955937 CTGCTGAAAGGGAGAAAAGGAGG - Intergenic
1149242040 17:54662485-54662507 CTGGAGAAATGGACAGAAGTAGG - Intergenic
1149784838 17:59426001-59426023 CTGCTTAAATGGAGGCAAGGAGG - Intergenic
1149923400 17:60679286-60679308 CACCAGAAAGGGAAAAAAGGAGG - Intronic
1152351286 17:79785255-79785277 CTGCAGAGGTAGGAACAAGGTGG - Exonic
1152463936 17:80455267-80455289 CTGCAGCAGGGGAAAGAAGGAGG + Intergenic
1153055385 18:940792-940814 CTGAAGAAAAGGAGAAAAGGAGG - Intergenic
1155775032 18:29751111-29751133 CTTCTGAAATGCAAAAAAGGAGG - Intergenic
1157598050 18:48875684-48875706 CTGCAGAGATGGAGACTAGATGG - Intergenic
1157892572 18:51432130-51432152 CAGCAGGAAGGGAAACATGGAGG - Intergenic
1158254412 18:55529852-55529874 CTGCAGAAATGGCCACAAGGAGG - Intronic
1159414679 18:68129144-68129166 CAGAAGAAAAGGAAACCAGGGGG + Intergenic
1159434923 18:68404532-68404554 CTACAGAAATGGAAACAGAATGG + Intergenic
1159627924 18:70715830-70715852 CTGGAAAAATGGAATCAAGTTGG + Intergenic
1160053345 18:75456586-75456608 CTGCAGTACTGGAAACAGGAAGG - Intergenic
1160470920 18:79132734-79132756 CTACAGAAAGGCACACAAGGAGG - Intronic
1160957668 19:1700877-1700899 CAGAAGAAATGGAAACTAAGAGG - Intergenic
1161944285 19:7425317-7425339 CTACATCAATGGAAAAAAGGTGG + Intronic
1164111145 19:22160546-22160568 CATCAGCAATGGAAAAAAGGTGG - Intergenic
1164480686 19:28609033-28609055 CAGTTGAAAGGGAAACAAGGTGG + Intergenic
1164622838 19:29707528-29707550 CTGCAGAAAGGAAACCAGGGAGG - Intronic
1164729538 19:30492229-30492251 ATGCAGAAATGGAGAGAAAGGGG - Intronic
1165168525 19:33873689-33873711 CAGCAGGATTGGAAACAAAGGGG - Intergenic
925251463 2:2442426-2442448 CTGCAGAAATACAGACCAGGTGG + Intergenic
925951818 2:8921515-8921537 CTCCAGAAATGGTAAATAGGTGG - Intronic
928128103 2:28629969-28629991 CTGCAAAAATGGGAACCAGCTGG - Intronic
928207858 2:29299932-29299954 CTGCAGTTTTGGAAACACGGTGG + Intronic
928573170 2:32628344-32628366 CGGCAGCAATGGAAACAGGAGGG + Exonic
929002610 2:37362947-37362969 CTGGAGAAATTGAACCAGGGAGG + Intronic
929346781 2:40894253-40894275 CTGTTGAAAGGGAAACAAGATGG + Intergenic
930095172 2:47561176-47561198 CAGCACACCTGGAAACAAGGAGG + Intronic
933582702 2:84145097-84145119 CAGCAGAGGTGGAAACAAAGAGG + Intergenic
933674326 2:85040467-85040489 CAGGAGAAATGGAAAAGAGGTGG - Intronic
934704059 2:96464009-96464031 CTGCAGAAATTAAAACAGTGTGG + Intergenic
935177236 2:100660290-100660312 AAGCAGAAATGGAGAGAAGGAGG + Intergenic
937157019 2:119727557-119727579 CCACAGAAATGGAAAGAAAGGGG + Intergenic
937339234 2:121080348-121080370 GTGGAGAAATGGACACTAGGTGG - Intergenic
937790653 2:125957681-125957703 CTGAAGAAAAGGAGACCAGGAGG - Intergenic
938277993 2:130044544-130044566 ATGCAGGAAAGGAAAGAAGGGGG + Intergenic
938437389 2:131292840-131292862 ATGCAGGAAAGGAAAGAAGGGGG - Intronic
938609282 2:132930459-132930481 GTGCAGAAAAGGTAAAAAGGTGG + Intronic
939119365 2:138098500-138098522 CAACAGAAATGGAAACACTGTGG - Intergenic
940088139 2:149885282-149885304 CTGAATAAATGATAACAAGGAGG - Intergenic
940827541 2:158429813-158429835 CTGAAGAAAATGAAACAAGTTGG + Intronic
941322025 2:164067651-164067673 CTCCAGAAATGGGAACAGAGAGG - Intergenic
941584794 2:167344225-167344247 CTGAAGATATGGAAACAAACTGG - Intergenic
943895459 2:193352430-193352452 AGGCAGAAACGGAAACATGGAGG + Intergenic
945625055 2:212193263-212193285 CTGCTGAAATGGAAAAGTGGGGG - Intronic
946322335 2:218961182-218961204 CGGCAGAAATGGAGAAATGGGGG - Exonic
946693631 2:222329995-222330017 CTACAGAAATCAAAACAATGTGG - Intergenic
947295374 2:228625047-228625069 CAGAAGAAAAGGAAAAAAGGTGG - Intergenic
948264030 2:236624654-236624676 CTGAAAAAGTGGAGACAAGGAGG - Intergenic
1169976788 20:11338195-11338217 CTGTTGCAATTGAAACAAGGGGG + Intergenic
1170058361 20:12232178-12232200 CTTCAGAAATGTAAACAACTAGG - Intergenic
1170694365 20:18645303-18645325 CTGCAGAAATGGAAACAAGGAGG + Intronic
1172408689 20:34707025-34707047 CTGCAGAAATGGAAACACCAAGG - Intronic
1172593130 20:36131566-36131588 CTGAGGAAGTGGACACAAGGTGG - Intronic
1173028976 20:39336852-39336874 ATCCAGAAATGGGAAGAAGGTGG + Intergenic
1173755646 20:45513573-45513595 CTGCAGAAATGAGTACAATGAGG - Intronic
1174183871 20:48691782-48691804 CTGCAGCAATGGAAACCAACAGG + Intronic
1174979298 20:55375212-55375234 CTATAGAAATGGAAACAAGAAGG - Intergenic
1175117696 20:56694645-56694667 CTGCAGAAATGAAACAAAGGAGG + Intergenic
1177004481 21:15654473-15654495 ATGCACAAATGGAAGCAACGAGG + Intergenic
1177221733 21:18202502-18202524 CTTCAGACATAGAAAGAAGGTGG + Intronic
1178324569 21:31633507-31633529 CTACAGAAATGAAAACAATATGG - Intergenic
1178701345 21:34835841-34835863 CTGCGGGAGTGGAATCAAGGGGG - Intronic
1179661507 21:42879007-42879029 CTGCAGAACTGGGAAGAAGCGGG - Intronic
1180523945 22:16236158-16236180 CAGCAGCAATGGAAAAAAGCTGG + Intergenic
1181730046 22:24838751-24838773 CTACAGAAATCAAAACAATGTGG - Intronic
1183230721 22:36580313-36580335 CAGCAGGAGTGGAACCAAGGAGG - Intronic
1183554213 22:38512659-38512681 CTGGAGAAAGGGAAGCCAGGAGG - Intergenic
1183978822 22:41528066-41528088 GTGCAGGAGGGGAAACAAGGTGG - Exonic
1184195972 22:42928340-42928362 CATCAGAAATGGACAGAAGGAGG + Intronic
1184277807 22:43420127-43420149 CTGAAGAAGTGGAAACAGAGAGG + Intronic
1184488541 22:44795962-44795984 CTGCAGACATGGAAAGGAGTAGG - Intronic
949143539 3:665871-665893 GTGAAGAAATGGAAAGAAGCTGG - Intergenic
949775677 3:7630013-7630035 CTTCAGAGTTGGAAACGAGGTGG + Intronic
949976476 3:9465518-9465540 CTGGAGAAGTGCAAACAAGGGGG - Intronic
950888652 3:16383273-16383295 CAGCAGAAATGAGAATAAGGTGG - Intronic
951511943 3:23512070-23512092 CTGCAGGACTGGAAATTAGGAGG - Intronic
953349692 3:42206066-42206088 CTGGAGAAATGGAAAGAAAGAGG + Intronic
953510947 3:43538608-43538630 CTGAAGAAACGGAAAAAATGAGG + Intronic
957022140 3:75138718-75138740 CAGTTGAAAGGGAAACAAGGTGG + Intergenic
957158975 3:76584042-76584064 CTGCTTAAATAGAAGCAAGGAGG - Intronic
957202175 3:77150024-77150046 CTGCAGAAAAGGAAAAAATCAGG - Intronic
957894690 3:86406629-86406651 ATGAAGAAACTGAAACAAGGAGG - Intergenic
959664640 3:108906962-108906984 GTGCAGAAACGGAGGCAAGGAGG - Intergenic
959724458 3:109528217-109528239 CGCCAGAAATGGAAAAAAGCAGG - Intergenic
960246514 3:115405724-115405746 CTGCAGAGATGAAAACCAGAAGG + Intergenic
960265451 3:115615980-115616002 CTTCAAGAATGGAAACAAGATGG + Intergenic
960673805 3:120176037-120176059 AAGCACAAATGGAAACCAGGGGG - Intronic
960767925 3:121158032-121158054 TGGCAGAAATGGAAACAAGTGGG - Intronic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961561366 3:127732676-127732698 CTGCAGATGTGCAAACAGGGAGG + Intronic
962732826 3:138299256-138299278 CTGCAGAGATAGAGAAAAGGTGG - Intronic
963191613 3:142479686-142479708 ATGGGGAAATGGAAACAAGTTGG - Intronic
963469323 3:145718672-145718694 GTGGAGCAATGGAAACAAGGAGG - Intergenic
964164436 3:153685388-153685410 TTGCTGAAATGGAGAAAAGGAGG - Intergenic
964183207 3:153912735-153912757 ATGATGAAATGGAGACAAGGTGG - Intergenic
966243257 3:177777937-177777959 CCCCAGAGATGGACACAAGGTGG - Intergenic
966274108 3:178143604-178143626 CTGCAGAAAGAGAAAGAAGTGGG - Intergenic
967847821 3:194058148-194058170 CTGCAGAAAAGAAAAAAAGAAGG + Intergenic
968527806 4:1072961-1072983 CTGCTGGAACGGAAACAAGACGG + Exonic
968912055 4:3481385-3481407 TTGCAGGAATGTTAACAAGGTGG + Intronic
969185442 4:5470985-5471007 CTGCAGAGATTGAAAGGAGGCGG - Intronic
971070924 4:23090232-23090254 ATGAAGTAATGGAAAGAAGGAGG + Intergenic
971195410 4:24468719-24468741 CTGGAAAATTGGAAACAATGAGG - Intergenic
971990079 4:33881193-33881215 CTCCAGAAATAGAGACTAGGAGG - Intergenic
972308323 4:37853869-37853891 CTGCAGAAATGGAGAAGAGGTGG + Intronic
972899904 4:43669963-43669985 CTACAGTAATTAAAACAAGGAGG - Intergenic
972972479 4:44594185-44594207 CTCCAGCAATGGAAAAAAGCTGG + Intergenic
973727621 4:53791876-53791898 CTGCAGAAATGGCGACAACAGGG - Intronic
974439619 4:61899322-61899344 TTGCAGAAATGGAAAGAGGTAGG - Intronic
974456379 4:62133871-62133893 CTGGAGAGCTGGAAACATGGAGG + Intergenic
975476661 4:74831355-74831377 CTGCTGAAATTGAACCAAGATGG - Intergenic
975804617 4:78099036-78099058 ATGCAGAATTGGAAACAGAGAGG - Intronic
976975778 4:91164957-91164979 CGCCAGCAATGGAAAAAAGGTGG - Intronic
978015589 4:103741464-103741486 CTGTAGATATGAAAACCAGGGGG - Intergenic
978120152 4:105069350-105069372 ATGCAGAAATGGAAACTCAGAGG - Intergenic
978636533 4:110814750-110814772 CCTAATAAATGGAAACAAGGGGG + Intergenic
979402547 4:120266163-120266185 CTGGAGCAAGGGAAACAAGAGGG - Intergenic
980028442 4:127795060-127795082 CTGCAGCAATGGAAGCAACATGG + Intronic
980116251 4:128681966-128681988 CTGCACAAATAAAAACAAAGTGG + Intergenic
980603471 4:135058310-135058332 TTGCAGAAATGAGAACAAGAAGG - Intergenic
983269542 4:165545167-165545189 CTGCAGCAATTCAAAGAAGGGGG + Intergenic
983443855 4:167823918-167823940 TTGCAGCAGTGGAAACAAGATGG - Intergenic
984588274 4:181587733-181587755 CTGATGTAATTGAAACAAGGTGG - Intergenic
986062491 5:4204736-4204758 CAGCAGGAATTAAAACAAGGAGG - Intergenic
987094950 5:14540744-14540766 CTACAGAAACGGAAACAAAAAGG - Intergenic
989026663 5:37075945-37075967 CTTAAGAAATGGAAACAGGCTGG + Intergenic
989507241 5:42241169-42241191 CTACAGAAATTAAAACAATGTGG + Intergenic
990630963 5:57668283-57668305 CTGCAGAAATGGAGAAAACTGGG + Intergenic
992837394 5:80654572-80654594 CTGCACAAATGGGGACGAGGGGG - Exonic
995180836 5:109228871-109228893 CTAAAGAAATGGAACCAATGGGG + Intergenic
996497341 5:124174847-124174869 CTGCAGAAATTTGCACAAGGAGG - Intergenic
996990945 5:129630372-129630394 CTGCAGTAATGAAGACAATGTGG + Intronic
999085170 5:148881837-148881859 GTGCAGATATGGAATCAAGCTGG - Intergenic
999599027 5:153239801-153239823 CATCAAAAAAGGAAACAAGGCGG - Intergenic
1000783368 5:165512552-165512574 TTGCAGAAGTGGAAAGAATGTGG - Intergenic
1000936560 5:167308808-167308830 CTAGAGAAATGGAAACACTGTGG - Intronic
1001642139 5:173252112-173252134 CTGCAGAAGGAGAAACAAGCAGG - Intergenic
1002958388 6:1891171-1891193 CTGTAGAAATGGAAACCACGTGG - Intronic
1003012029 6:2435361-2435383 CTGGAGTTATGGCAACAAGGAGG + Intergenic
1003693967 6:8383682-8383704 CTGCAGGAAAGAAAACAAGAGGG + Intergenic
1004801278 6:19151495-19151517 CTAAAGAAATGAAAACAATGCGG - Intergenic
1006991201 6:38216442-38216464 CTGCAGAAATGGAAGCATTTGGG + Intronic
1007065866 6:38989914-38989936 CTGTTAAAATGGAAATAAGGTGG + Intronic
1007463511 6:42035322-42035344 CAGTAGAAATGGAAACAAGGGGG - Intronic
1007974302 6:46085293-46085315 CAGCAGCAATGGAAAAAAGCTGG - Intergenic
1008513447 6:52298365-52298387 CTGTATGAATGGAAACAAGAGGG - Intergenic
1009901952 6:69818583-69818605 CTGCAAAGTAGGAAACAAGGGGG + Intergenic
1009962272 6:70538302-70538324 ATGCAGAAATGGAAAAAATCAGG + Exonic
1010021265 6:71162590-71162612 CTGCAGAGCTGTAAACAAAGTGG - Intergenic
1010762214 6:79736376-79736398 CTGCCAAAATGGAAATCAGGAGG - Intergenic
1011084607 6:83524849-83524871 GTGCAGATATTGAAACTAGGTGG + Exonic
1011151946 6:84283986-84284008 CTGCAGTAATGAAAACATTGTGG - Intergenic
1013699607 6:112749303-112749325 CTGCACAAAGGGAAACATTGAGG + Intergenic
1015463853 6:133525299-133525321 CTACAGAAATGCAAACAAAAAGG - Intronic
1016831522 6:148438503-148438525 CGGCAGCAATGAAAACCAGGAGG + Intronic
1016832061 6:148444079-148444101 AAGCAGAAATGCAAAGAAGGAGG + Intronic
1016892093 6:149016864-149016886 CTGCAGCAGTGGCAACAGGGAGG - Intronic
1016914137 6:149228991-149229013 TTTGAGAAATGGAAAAAAGGGGG + Intronic
1016932931 6:149427472-149427494 CTGCAGAAATGGTCACAGGTGGG + Intergenic
1017126335 6:151067802-151067824 CTCCAGGAATTGAAACATGGTGG + Intronic
1017126430 6:151068941-151068963 CTACAGAAAAGGAATCAAAGCGG - Intronic
1017685271 6:156907081-156907103 CTGCAGAAAGGCAAAAAAGCAGG - Intronic
1017785465 6:157753437-157753459 CTGAAGAAATGTAAACAACTTGG - Intronic
1018309326 6:162492030-162492052 CAGAGGAAATGGAAACAAGATGG + Intronic
1019005806 6:168795457-168795479 CTGAAGAAAAGGGAACCAGGAGG - Intergenic
1019174649 6:170153967-170153989 CTGCAGACATGGAAGCCAGCAGG + Intergenic
1019930534 7:4220076-4220098 CAGAAGCAAAGGAAACAAGGGGG - Intronic
1020767089 7:12336206-12336228 TTGCAGAAATGTAAAAACGGTGG - Exonic
1020952185 7:14694118-14694140 CTGGAGGAATGGATTCAAGGAGG - Exonic
1021104391 7:16620177-16620199 ATGCAAAAATGGAGACAAAGGGG + Intronic
1021191046 7:17620081-17620103 GTGCAGAAATGGAAACAGACTGG + Intergenic
1021790251 7:24197441-24197463 CAGGATAAACGGAAACAAGGAGG - Intergenic
1022745583 7:33168433-33168455 CTGCAAAAAGGAAAAAAAGGAGG - Intronic
1023629210 7:42146920-42146942 CTGCAGATACAGAAATAAGGAGG - Intronic
1023767981 7:43529600-43529622 CTACTGAAATGGAAACACTGAGG + Intronic
1025248939 7:57338781-57338803 CTGGAGGAAGGGAAATAAGGAGG + Intergenic
1025984603 7:66437658-66437680 GTGTAGAAATGGAAAATAGGTGG + Intergenic
1026030110 7:66785288-66785310 GTGTAGAAATGGAAAATAGGTGG - Intronic
1026052600 7:66959798-66959820 CTTCAGAGGTGGAAACAATGTGG - Intergenic
1026552861 7:71382582-71382604 CTGCAGTAACCGAAACGAGGTGG + Intronic
1027123856 7:75541981-75542003 CTGCAAGGATGGAAACAAGAAGG + Intronic
1027207806 7:76116246-76116268 GTGTAGAAATGGAAAATAGGTGG + Intergenic
1027965457 7:84999866-84999888 CTGCAGAATTGGAAAAATGTAGG + Intronic
1028532904 7:91858389-91858411 TTGAATAAATGGAAACAATGTGG + Intronic
1028671417 7:93404822-93404844 ATGAAGAAATGTAATCAAGGAGG - Intergenic
1028820751 7:95209018-95209040 CAACTGAAATGGAATCAAGGAGG + Intronic
1028848201 7:95506588-95506610 CTGCAGTACTGGAAACTAGAAGG - Intronic
1029378728 7:100198792-100198814 CAGCACAACAGGAAACAAGGAGG - Intronic
1029478929 7:100801461-100801483 GTGCAGAAATGGAAAAAGGTTGG + Intergenic
1029639576 7:101811373-101811395 GTCCAGAAGTGGAAAGAAGGGGG + Intergenic
1030199868 7:106891837-106891859 CTGCGGAACTGGAAACAGGGTGG - Intronic
1030690727 7:112529796-112529818 AGGCAGAAATGGAAATAAAGAGG - Intergenic
1030945924 7:115720153-115720175 GTGAAGAAAAGGAAGCAAGGGGG + Intergenic
1031071804 7:117170086-117170108 CTGTAGAAGGGTAAACAAGGGGG - Intronic
1032512644 7:132484198-132484220 CAGAAGAGATTGAAACAAGGTGG + Intronic
1032518376 7:132523761-132523783 CTGGTGATGTGGAAACAAGGGGG + Intronic
1032866462 7:135930145-135930167 CTGCAGAAAAACAAACAAGTTGG + Intronic
1034286465 7:149886566-149886588 CTACAGAAATGCAAACAGTGGGG + Intergenic
1034418155 7:150975953-150975975 TGGCAGAAATGGAACCATGGGGG - Intronic
1035737744 8:1901066-1901088 AGGCAGAGTTGGAAACAAGGTGG + Intronic
1036407213 8:8465880-8465902 CTGCATAAATGGGGAGAAGGAGG + Intergenic
1036509641 8:9388357-9388379 CTGGAAAACTGGAAACTAGGAGG + Intergenic
1036672489 8:10801186-10801208 CTGCAGAAAGGGAAGGAAGGGGG + Intronic
1036797681 8:11768268-11768290 CTACAGAAAGAGAAACTAGGGGG + Intergenic
1037165137 8:15817966-15817988 CTCTAGGAATGGAAAAAAGGAGG + Intergenic
1038562199 8:28590198-28590220 ATGCAGAAATGCAAAAAGGGAGG + Intergenic
1039003586 8:33008866-33008888 CAGAAGAAATGGAAACAAAAAGG + Intergenic
1039670836 8:39595867-39595889 TTGGAGAAATGGAAACAAGAAGG - Intronic
1040738230 8:50537634-50537656 CTTAAGAAATGGAAACAATCAGG - Intronic
1040835237 8:51724013-51724035 GTGCAGAAAAGGAAAGAGGGAGG + Intronic
1041681930 8:60602680-60602702 CTGCAGAATTAGATCCAAGGAGG + Intronic
1042508904 8:69590936-69590958 CAACAGAAATGGGAACAGGGGGG - Intronic
1042873368 8:73418155-73418177 ATACAGAAATGGGAACATGGGGG + Intergenic
1042881681 8:73499502-73499524 CTGCAGAAAAGGCAAGTAGGAGG + Intronic
1043217055 8:77605240-77605262 CAGGAAAAATGGAACCAAGGTGG + Intergenic
1043476976 8:80614913-80614935 CTTCAGACAGGCAAACAAGGGGG - Intergenic
1043950529 8:86304003-86304025 CTACAGAAATGTGAACCAGGTGG + Intronic
1044740473 8:95321378-95321400 GAGCAGAAATGGAGAAAAGGAGG - Intergenic
1046023092 8:108689868-108689890 CTGGAGAAATGGAGAGGAGGGGG - Intronic
1046598922 8:116295213-116295235 ATGCATGAATGGAAAAAAGGGGG + Intergenic
1046749481 8:117911969-117911991 CTGCAGAAATGCACAAAAAGAGG + Intronic
1046794572 8:118357013-118357035 GAGCAGAAATGAAACCAAGGAGG - Intronic
1046804028 8:118460544-118460566 ATGCAGACATGGAATCAGGGAGG + Intronic
1047158166 8:122345346-122345368 ATGTGGAAAGGGAAACAAGGTGG + Intergenic
1048087865 8:131203393-131203415 CTGCAGACATGGAGATATGGAGG + Intergenic
1048884427 8:138898305-138898327 CTCCAGAAATGGAAACACCCTGG + Intronic
1049619061 8:143589619-143589641 CTGCACCCATGGAAACCAGGTGG - Exonic
1049866180 8:144938150-144938172 CTGCAGTAATCAAAACAATGTGG - Intronic
1051915270 9:22200181-22200203 CTGCTGAAATGCAGACAAGAAGG - Intergenic
1052049427 9:23828065-23828087 TTGAAGAAATGGAGTCAAGGGGG + Intergenic
1054818408 9:69497691-69497713 CTGTGGAAATGGAAAAGAGGAGG - Intronic
1055065160 9:72111222-72111244 CTGCAGAAAAGAAAGCAAGGTGG - Intergenic
1055219234 9:73908207-73908229 CTGGAGTAAGGGAAACAAGGTGG + Intergenic
1055996685 9:82167835-82167857 CTGCAGAAAAGGAAACAAAGAGG - Intergenic
1059468255 9:114483382-114483404 TTGTAGAAATGGAGACAAGAAGG - Intronic
1059657349 9:116368679-116368701 CTGGAGAAACCGAAAGAAGGAGG + Intronic
1059705332 9:116817518-116817540 CTCCAGAAACTGAAACCAGGAGG + Intronic
1061344443 9:130011029-130011051 CAGCAGAGATGGAAGGAAGGTGG + Intronic
1061467971 9:130797973-130797995 CTGAAGAAATTAAATCAAGGAGG - Intronic
1186503219 X:10068703-10068725 CTGCAGAGATGGAGATAAGATGG - Intronic
1186541255 X:10402837-10402859 CTGCAGTAATCAAAACAGGGTGG - Intergenic
1187846463 X:23542764-23542786 CTTCAAAAAGGGAAACAAGTAGG + Intergenic
1188459493 X:30407272-30407294 CTACAGAAATGGAAAGAAGAGGG - Intergenic
1189528192 X:41848817-41848839 CTACAGAACTGGAAGAAAGGGGG + Intronic
1189920702 X:45900654-45900676 CTGAAGAAAATGAAACATGGAGG - Intergenic
1190256280 X:48765108-48765130 CTGCAGAATGGGAAAGGAGGGGG + Intronic
1190930680 X:54947390-54947412 CTCCAGAACCTGAAACAAGGAGG + Intronic
1191023856 X:55892453-55892475 CAGGAGAAAGGGAAAGAAGGAGG + Intergenic
1192312055 X:70025106-70025128 CTGCAGAACTGGAACAAAGCAGG + Intronic
1193118966 X:77803431-77803453 TTGCAGAAAAGGAAATAAGAAGG - Intergenic
1193752968 X:85370105-85370127 CTGCAGAAATTTAAACAAATAGG + Intronic
1194470896 X:94295607-94295629 CTCAAGAAATGGAGAGAAGGAGG + Intergenic
1195062627 X:101211072-101211094 CTTCATAAATGGAGACAATGAGG - Intergenic
1195077149 X:101338096-101338118 AAGCAGAAATGGAGAGAAGGAGG - Intergenic
1197173329 X:123458327-123458349 ATGGAGAAATGGAAACAGAGAGG + Intronic
1197796393 X:130303278-130303300 CTGCAGTAATCGAAACACTGTGG - Intergenic
1197802973 X:130371558-130371580 CTGCAGATGTGGAAACATGAGGG + Exonic
1198066831 X:133106542-133106564 CTGGAGAAATAGAAACAATAGGG - Intergenic
1199119693 X:144036977-144036999 CTGCGAAAATCGAAGCAAGGTGG + Intergenic
1199226176 X:145377420-145377442 CAACAGAAATGGACACAAGATGG + Intergenic
1199272415 X:145899319-145899341 CTGCAGAAATGGAAGGCAGCAGG - Intergenic
1199313198 X:146345641-146345663 CTGTATATATGGACACAAGGTGG + Intergenic
1199504539 X:148546774-148546796 CTGCAGAGAAGGAAACACTGAGG - Intronic
1199510701 X:148618665-148618687 CAGCAGAAATTGATACAAGGTGG + Intronic
1199971913 X:152867565-152867587 CTGCAGAAATGGGAAGAACTTGG + Exonic
1200836256 Y:7734662-7734684 CAGCAGAAATGAGAAGAAGGTGG - Intergenic