ID: 1170696141

View in Genome Browser
Species Human (GRCh38)
Location 20:18660878-18660900
Sequence GCTTCCATGTTAGGAGAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170696141_1170696144 11 Left 1170696141 20:18660878-18660900 CCGGTTTCTCCTAACATGGAAGC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1170696144 20:18660912-18660934 CCACAGATAATATCCCAACCAGG 0: 1
1: 0
2: 1
3: 5
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170696141 Original CRISPR GCTTCCATGTTAGGAGAAAC CGG (reversed) Intronic
901329762 1:8397032-8397054 TCTTCCCTGGGAGGAGAAACAGG + Intronic
901444909 1:9302330-9302352 GCTTCCCTGTCAGCAGAAAAGGG - Intronic
901445138 1:9303914-9303936 GCTTCCCTGTCAGCAGAAAAGGG - Intronic
903028404 1:20445530-20445552 GCTTCCATGTCACCAGAAGCAGG + Intergenic
909161734 1:72160200-72160222 GCTACCATCTCAGAAGAAACAGG + Intronic
911413680 1:97543407-97543429 ACATCCATGTTGGGAGAAAGTGG - Intronic
912652380 1:111450809-111450831 GCTTCCAACTTAGAAGAAAAAGG + Intronic
916119193 1:161512658-161512680 GCTTCCATGACAGTAGGAACAGG + Intronic
916369564 1:164074962-164074984 GTTTCCTTTTGAGGAGAAACAGG - Intergenic
919035274 1:192299540-192299562 GCTTACATATAAGGAGCAACTGG + Intergenic
919682283 1:200447520-200447542 GATTCCATTTTAGGAGCCACTGG + Intergenic
920969148 1:210727725-210727747 TCTTGCATGTTAGCTGAAACTGG - Intronic
922368128 1:224885123-224885145 GCTTCCAACTTAGGACCAACTGG - Intergenic
922564316 1:226591472-226591494 GCTTATATGTTAGGAAAAGCTGG - Intronic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
924701074 1:246453196-246453218 GCTAGCAAGTTAGTAGAAACAGG + Intronic
1064812825 10:19220884-19220906 GGGGCCATGTTAGGAGAAAGTGG - Intronic
1065670460 10:28110555-28110577 GATTTCATGTTGGGAGTAACAGG + Intronic
1067899928 10:50229340-50229362 GCTTTCATGTAAGGGGAAAAAGG + Intronic
1068176455 10:53465821-53465843 GCTTGGATGTTAGGAGGAAGGGG + Intergenic
1069839667 10:71331723-71331745 GCTACAAAGTTAGGGGAAACAGG - Intronic
1071894368 10:90049761-90049783 GCTTACAAGCCAGGAGAAACTGG - Intergenic
1072004023 10:91224894-91224916 GGTTCCATGCTTGGTGAAACGGG - Intronic
1073450168 10:103604423-103604445 ATTTCCATGTTAGTATAAACTGG + Intronic
1076787768 10:132759609-132759631 GCTTCGATGTTAGCAGGAATGGG - Intronic
1081479871 11:43476110-43476132 GCTTCCATTTTAGTGGAAAGTGG + Intronic
1082724418 11:56718323-56718345 GTTTCCAGGGTAGTAGAAACTGG - Intergenic
1083639566 11:64138201-64138223 GCCTCCTTGTTAGGAGGAAGAGG + Intronic
1089375238 11:117989333-117989355 GCTCCCACATTGGGAGAAACTGG - Intronic
1093594613 12:20945724-20945746 GCTCCCTTTCTAGGAGAAACAGG + Intergenic
1095576103 12:43741197-43741219 GCTTAAATGTTATGAGAAACAGG + Intronic
1095598668 12:43990059-43990081 GCTTCCATATTAGGAAATGCTGG - Intronic
1097359492 12:58642811-58642833 GCTTCCATGATTGAAGAATCAGG - Intronic
1098942720 12:76556544-76556566 GCTTCCTTGTGATGAGACACAGG - Intronic
1099141757 12:78986097-78986119 ACTTCCTAGTTAGAAGAAACTGG - Intronic
1100589052 12:96007662-96007684 TCTTCAATATTAGTAGAAACAGG - Intronic
1103078519 12:118004739-118004761 GATTCCATGTAGGGAGAAAAAGG + Intergenic
1110167369 13:72459943-72459965 GCTTCTATAATAGGAGAAATGGG + Intergenic
1112719948 13:102232888-102232910 GCTTATATATTAGGTGAAACAGG + Intronic
1114492675 14:23113190-23113212 GCTTCCCTTTTAGAAGAAACAGG - Intergenic
1116577568 14:46594058-46594080 GTTTCAAGGTTTGGAGAAACAGG - Intergenic
1117810109 14:59536571-59536593 ACTACAATGTTAGAAGAAACGGG - Intronic
1121896766 14:97655960-97655982 GCTGTCAGGTGAGGAGAAACTGG - Intergenic
1124872760 15:33559341-33559363 GCAGCCATGTGAGGAGACACAGG + Intronic
1126650672 15:50918407-50918429 GCTTCCATGTTAGCATAGGCAGG + Intronic
1127811545 15:62569421-62569443 TCTTCCCTCTTAGGAGAAACTGG + Intronic
1131858419 15:96624992-96625014 CCTTCCAGGTTAGAAGAACCAGG + Intergenic
1133748231 16:8703597-8703619 GCTGACATGTTAGCAGAAAAAGG + Intronic
1141319732 16:82996131-82996153 TCTTCCATTTTAGGAAAAAAAGG + Intronic
1143515799 17:7418651-7418673 CCTGCCATGTGAGGAGGAACTGG - Exonic
1145287073 17:21513787-21513809 GCTTCCAACTTAGGACCAACAGG + Intergenic
1155219581 18:23672007-23672029 GCTTCCAGGTTCTGAGAAATTGG + Intergenic
1155467264 18:26151109-26151131 TCTTCCAGGTTTGTAGAAACAGG + Intronic
1155629958 18:27881620-27881642 GGTTGGATGTTAGGAGAAAAGGG - Intergenic
1159877590 18:73829521-73829543 GCTTTTATGATGGGAGAAACAGG + Intergenic
1166568195 19:43777845-43777867 GCAGCCCTCTTAGGAGAAACAGG - Intronic
926367308 2:12145076-12145098 GCTTCCATGCCAGAAGAAACAGG - Intergenic
930315356 2:49790842-49790864 GGTTCTATGTTAGGAAGAACAGG - Intergenic
932229088 2:70067569-70067591 TATTCCATGTTAGTACAAACAGG - Intergenic
933308754 2:80634626-80634648 GCTTCCATTTGAGAATAAACGGG + Intronic
933675201 2:85049631-85049653 GCTACCTTGTTAAAAGAAACTGG - Exonic
938784384 2:134611836-134611858 GCCTCCATGTTGGGGGAAACAGG + Intronic
939431394 2:142113504-142113526 GCTTCAAAGTTAGGAGAAAGTGG + Intronic
941788122 2:169521087-169521109 GCTTGCATGTTGGGAAAATCTGG - Intronic
946635371 2:221719246-221719268 GCTTCCAATTTAGGACCAACTGG + Intergenic
948551614 2:238776371-238776393 GCCTCCAGGTGAGGAGAAGCAGG - Intergenic
1170696141 20:18660878-18660900 GCTTCCATGTTAGGAGAAACCGG - Intronic
1170758000 20:19221868-19221890 GCTTCCAGTTTAAGAGAACCTGG - Intronic
1171438508 20:25142426-25142448 GGTTCCATGTTAGGACTGACGGG - Intergenic
1173434350 20:43019278-43019300 GCTTCCCTTTTAGCAGAAATGGG - Intronic
1173794581 20:45850303-45850325 GCTTCCAACTTAGGACCAACCGG - Intronic
1177475777 21:21619980-21620002 GCTTCCAATTCAGGAGACACAGG - Intergenic
1179921058 21:44507844-44507866 GCAGCCATGGCAGGAGAAACAGG - Intronic
951059177 3:18184460-18184482 GCTGCCAAATTAGGAGAAATAGG - Intronic
951168269 3:19507672-19507694 GCCTCCCAGTAAGGAGAAACAGG + Intronic
951367257 3:21798464-21798486 GCTTCCATGCTGTGAGAAAAGGG - Intronic
952392995 3:32896992-32897014 GCATCGATTTTAGGAGAAAAGGG - Exonic
956202572 3:66721543-66721565 TCTATCATGTTAGGAGAAAATGG - Intergenic
957290028 3:78268117-78268139 GCTTCCATGTTAGCAGGTATAGG + Intergenic
959717078 3:109444565-109444587 ACTTCCCTGGTTGGAGAAACAGG + Intergenic
960532374 3:118779672-118779694 GTGTCCATGTTAAGAGAGACAGG + Intergenic
961441177 3:126954230-126954252 GCTCCCAGTTTAGGAGAAACTGG - Intronic
962349392 3:134645416-134645438 GCTTCCATCTTAGAAGGAAGTGG - Intronic
963608413 3:147434591-147434613 GCTTACATGAAAGGAAAAACAGG - Intronic
964678746 3:159314278-159314300 GTTTCCATCTCAGCAGAAACTGG + Intronic
965921756 3:173925554-173925576 GCTCCCAGGTTAGCAGAAAGTGG - Intronic
970465373 4:16317143-16317165 GCTTCAATCTTGGGAAAAACAGG - Intergenic
971255657 4:25011202-25011224 TCTTCCATGTCAGGACAAAGGGG + Intronic
972168098 4:36311679-36311701 GTGACCATGGTAGGAGAAACTGG - Intronic
978563569 4:110058633-110058655 ACTCCCTTTTTAGGAGAAACAGG + Intronic
978595693 4:110374626-110374648 GCTGCCATGCCAGGAGAAACCGG + Intronic
980848223 4:138349791-138349813 CCTTCCAAGAGAGGAGAAACTGG - Intergenic
981952180 4:150422863-150422885 GCCTCCATGTTAGGAGGCCCTGG - Intronic
985815239 5:2123771-2123793 TCTCTCATGTTAGGAGACACTGG + Intergenic
986967513 5:13292380-13292402 GCTTGCATGTAAGGAGAAAGAGG + Intergenic
987685446 5:21193589-21193611 GCTTCCCTGCTAGGAGGCACTGG + Intergenic
989468390 5:41785259-41785281 TATTCCCTGTTAGGACAAACAGG + Intronic
993406102 5:87513278-87513300 GCTGCCAAGTAAAGAGAAACTGG + Intergenic
995088278 5:108141011-108141033 ATTTCCATGTTAGGACAAATAGG - Intronic
997578923 5:135005097-135005119 GCTTCCATCTTGGAAGAAAGGGG + Intronic
1000046730 5:157527993-157528015 GCTCCCATGATTGGAGAAATAGG - Intronic
1003858305 6:10298303-10298325 GCCTCTATTTTAGGAAAAACAGG - Intergenic
1004416154 6:15426045-15426067 GCTACCATGTTCACAGAAACAGG - Intronic
1008881623 6:56386018-56386040 GCTTCCCTGTTATGTAAAACAGG + Intronic
1009705096 6:67239378-67239400 GGTTCCGTGTTAGGAGAGAGCGG - Intergenic
1013695660 6:112699917-112699939 TCTTCCATAATAGTAGAAACAGG + Intergenic
1018362793 6:163088434-163088456 GCTCCCATGATTGAAGAAACTGG + Intronic
1020660022 7:10971366-10971388 GCTTCCATTTTTGAAGAAAAAGG + Intergenic
1020861779 7:13502542-13502564 TCTTCCATGTTAGGATACAATGG + Intergenic
1025101815 7:56141863-56141885 GCTTCCACATTATGAGAAAAAGG + Intergenic
1026317507 7:69239958-69239980 GCTTCCACATTATGAGAAAAAGG - Intergenic
1030498986 7:110335411-110335433 GCTCACATGTTATTAGAAACAGG - Intergenic
1030813079 7:114000420-114000442 GCTTACATCTTAGCAGACACTGG - Intronic
1032849875 7:135784898-135784920 GCTTACAGTTTAGGAGAAAGTGG + Intergenic
1034688400 7:152994493-152994515 GCTTCCTGGTTAGAAGGAACAGG + Intergenic
1036442702 8:8795609-8795631 GTTTCCCAGTTTGGAGAAACGGG + Intronic
1038047374 8:23777127-23777149 GCTACTATGTTTGGAGAAACAGG + Intergenic
1038831691 8:31068991-31069013 CATTCCATGTTTGGAGAAACAGG - Intronic
1039659084 8:39444253-39444275 CCTTCAATCTGAGGAGAAACGGG - Intergenic
1041443473 8:57924654-57924676 GCTTAAATATTAGGAAAAACTGG - Intergenic
1041759932 8:61355031-61355053 ACTTCATAGTTAGGAGAAACAGG - Intronic
1042134636 8:65621269-65621291 GCTTCCACATTAGCAGCAACAGG + Intronic
1047600195 8:126418434-126418456 ACTTCCATGTTTGGGGAAAGGGG + Intergenic
1048691016 8:136963418-136963440 TCTTCCATGTTTGGAGAGAAGGG + Intergenic
1055194082 9:73565418-73565440 TCTTCTATGTTAGGAGGATCTGG - Intergenic
1057397362 9:94692024-94692046 GTTTCCCTGTTTGGAGCAACTGG - Intergenic
1059478598 9:114570264-114570286 TCTCCCATGTTAAGATAAACAGG - Intergenic
1186859464 X:13657271-13657293 TCTTCAAACTTAGGAGAAACTGG + Intronic
1187396773 X:18926299-18926321 GCTTCGATGTGAAGAGGAACGGG - Intronic
1192185912 X:68946758-68946780 GCCTCCATGTTGGGAGAAAGAGG + Intergenic
1192380454 X:70611209-70611231 TTTTACTTGTTAGGAGAAACTGG - Intronic
1193986266 X:88244229-88244251 GCTCCCATGCTGGGAGAATCTGG + Intergenic
1197832068 X:130653655-130653677 CCTTCCATGTTAGCAGCAAGTGG + Intronic
1200370738 X:155721621-155721643 GCTTACAGGTTAGGAGAGAGTGG + Intergenic
1201017221 Y:9618140-9618162 AGTTCCATGGTAGGAGCAACTGG - Intergenic