ID: 1170698606

View in Genome Browser
Species Human (GRCh38)
Location 20:18683177-18683199
Sequence GCGCATATGACAGTAGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170698600_1170698606 23 Left 1170698600 20:18683131-18683153 CCAGGCAGCTTTTTGTTGGTCAG 0: 1
1: 0
2: 4
3: 22
4: 201
Right 1170698606 20:18683177-18683199 GCGCATATGACAGTAGGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170698606 Original CRISPR GCGCATATGACAGTAGGGTC TGG Intronic
901533139 1:9866181-9866203 GCACATGTGACAGGAGGGCCTGG + Intronic
914397126 1:147280297-147280319 GCCCAAATGACAATAGGGTAAGG - Intronic
1083314363 11:61805178-61805200 GGGCAGATGACTGTAGGGACAGG - Intronic
1085441748 11:76570556-76570578 GCTCACATGACTGTAGGGGCTGG - Intergenic
1093315368 12:17643611-17643633 GCTCATATGACTGTAGGGTAAGG - Intergenic
1103738512 12:123076207-123076229 GCCCAGATGCCAGGAGGGTCTGG + Intronic
1106323222 13:28661638-28661660 GCGCATTTCACAGTAGCGTAGGG + Intronic
1115471569 14:33773684-33773706 GCTCATACTAAAGTAGGGTCAGG - Intronic
1123767828 15:23499432-23499454 CCTCATATGGCAGAAGGGTCAGG - Intergenic
1129004015 15:72357250-72357272 GAGCAGATGACAGAAGGATCAGG + Intronic
1137832814 16:51560303-51560325 GCTCATGTGACTGTAGGGGCTGG - Intergenic
1139138650 16:64234347-64234369 GAGCAAATGAGAGCAGGGTCCGG - Intergenic
1142277835 16:89132347-89132369 GCTCATAGGTCAGGAGGGTCTGG - Intronic
1147165554 17:38591355-38591377 GGGCTTATGACAGAAGGTTCCGG - Intronic
1166326345 19:42053486-42053508 GCGCATAGGCCAGTGGGGGCTGG - Intronic
926817796 2:16817411-16817433 GCCCATATGGCAGTTGGCTCTGG - Intergenic
928064190 2:28146952-28146974 GAGCAGAAGAGAGTAGGGTCTGG + Intronic
933700748 2:85253912-85253934 TCACACATGACAGTGGGGTCTGG - Intronic
941669384 2:168275336-168275358 GTGCAGATGATTGTAGGGTCTGG - Intergenic
946079372 2:217104253-217104275 GTGTATATGGCAGTAGGGGCTGG + Intergenic
1170698606 20:18683177-18683199 GCGCATATGACAGTAGGGTCTGG + Intronic
1170892347 20:20386908-20386930 GTCCCTATGACAGCAGGGTCAGG + Intergenic
1175441654 20:58996458-58996480 GCGCATGTCAGAGAAGGGTCTGG + Intronic
1177653865 21:23991548-23991570 GTGTATATGACAGTAGGGTTGGG + Intergenic
1181997998 22:26898087-26898109 GCACAAATGACTGTAGGGCCAGG + Intergenic
949906856 3:8864897-8864919 GAGCAGCTGACAGGAGGGTCAGG + Intronic
955586900 3:60488579-60488601 GGGCCTATGACAGCAGGGTAGGG + Intronic
955781672 3:62491162-62491184 GCCCAAATGGCAGGAGGGTCGGG - Intronic
971585749 4:28403456-28403478 TCGCATATGACTCTAGGATCTGG + Intergenic
977919721 4:102629634-102629656 GAGCATATGACAGTAAGACCTGG + Intergenic
978336869 4:107678813-107678835 GTGGATATGAAAGAAGGGTCTGG - Intronic
990084753 5:51961474-51961496 GAGTAGATGACAGGAGGGTCAGG - Intergenic
996842040 5:127857608-127857630 GCTCACATGACTGTAGGGGCTGG + Intergenic
1007109234 6:39303563-39303585 GGGGATCAGACAGTAGGGTCCGG - Intronic
1008691258 6:53981755-53981777 GCGCATTTCACAATAGGGTTTGG - Intronic
1013166785 6:107601334-107601356 TCCCATATGAGAGTAGGGCCTGG + Intronic
1023159835 7:37286317-37286339 GCCCATCTGACACTAGTGTCTGG - Intronic
1029863150 7:103597243-103597265 GCCCACAGGACAGGAGGGTCAGG - Intronic
1034452349 7:151143772-151143794 GAGCATATGCCAGTGGAGTCAGG - Exonic
1037999564 8:23379945-23379967 GCTCGTAGGACAGTGGGGTCAGG - Intronic
1041077117 8:54178666-54178688 CCGAATTTGACAGTAAGGTCTGG + Intergenic
1048970278 8:139641535-139641557 GGGCATGTGACAGCAGGCTCCGG - Intronic
1050846905 9:10232355-10232377 AAGAATATGACAGTAGGGTTTGG + Intronic
1059869214 9:118552608-118552630 GTGAAAATGACAGTAGGGTTTGG - Intergenic
1060291338 9:122305625-122305647 GAGCAGATGACACTGGGGTCAGG + Intronic
1198366923 X:135950306-135950328 TCGCAAATGACAGTAGCATCTGG + Intergenic